الفهرس 
COVEROnly 14 pages are availabe for public view
 |  | from | 131 |  |  |
| | | from | 131 | | |
Abstract
ـــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــ
Faculty of Veterinary Medicine
Department of Animal Hygiene and Zoonoses
Impact of Thiamethoxam polluted water on health condition of Nile Tilapia
A thesis submitted in partial fulfillment of the requirements for the degree of master of Veterinary Sciences
Specialty
Animal Hygiene
Presented by
El-Shaymaa El Sayed Noshi Ibrahim
(B. V. Sc. Faculty of Veterinary Medicine, Alexandria University, 2020)
(2024)
Advisors’ committee
Prof. Dr. Mohammad Al Sayed Nossair
Professor and Head of Department of Animal Hygiene and Zoonoses Faculty of Veterinary Medicine, Alexandria University.
Dr. Alaa Mohammad Al Sayed Mansour
Lecturer of Animal Hygiene
Department of Animal Hygiene and Zoonoses
Faculty of Veterinary Medicine, Alexandria University
Dr. Rehab Ali Abd- Elaziz El Sayed
Fish Diseases Department, Alexandria Provincial Lab, Animal Health
Research Institute (AHRI), Agricultural Research Center (ARC), Egypt
Acknowledgment
Firstly, many great thanks to our merciful ALLAH who always beside me and gave me the ability to finish this work.
I would like to express my sincere gratitude to Prof. Dr. Mohammad Al- Sayed Nossair; Professor of Zoonoses, Head of Animal Hygiene and Zoonoses Department, Faculty of Veterinary Medicine, Alexandria University; for his relentless support and golden advice that enabled me to tackle many hardships during this work. His motivation and assistance inspired me deeply and showed me that work alone is meaningless without passion and zealot. His scientific expertise and kind soul will always enlighten my scientific path.
Undoubtedly, I cannot forget to express my deepest appreciation to my supervisor Dr. Alaa Mohammad Mansour Lecturer of Animal Hygiene, Faculty of Veterinary Medicine, Alexandria University for his continuous help and support that enlightened me a lot during performing this work. His insightful remarks and constant assistance throughout all phases of this work have remarkably contributed to this work accomplishment. I am thankful for her patience and her pursuit to improve my work quality.
Also, my great appreciation goes to Dr. Rehab Ali Abd- Elaziz El Sayed Fish Diseases Department, Alexandria Provincial Lab, Animal Health Research Institute (AHRI), Agricultural Research Center (ARC), Egypt for her valuable advices, fruitful suggestions and continuous encouragement as well as her generous efforts in the evaluation of this work and I am always indebted for everything she offered for the completion of this work with improved quality.
I would like to express my sincere gratitude to Nourhan El Banhawy; Assistant lecturer, Department of Animal Husbandry and Animal Wealth Development, Faculty of Veterinary Medicine, Alexandria University for performing statistical analysis during my work.
Also, my great appreciation goes to Fish Diseases Department, Alexandria Provincial Lab, Animal Health Research Institute (AHRI), Agricultural Research Center (ARC), Egypt for technical support.
It is great pleasure to record all meaning of indebtedness to all staff members of Animal Hygiene and Zoonoses Department, Faculty of Veterinary Medicine, Alexandria University.
Contents
Page
1. Introduction. 1
2. Review of literatures. 4
3. Material and Methods. 23
4. Results. 30
5. Discussion. 74
6. Summary. 89
7. Conclusion and recommendations. 93
8. References. 95
9. Arabic summary
List of Tables
Table Title Page
I Description of experimental fish groups to evaluate effects of thiamethoxam 24
II Determination of serum biochemical indices 25
III Oligonucleotide primers and probes used in SYBR Green real time PCR 26
1 Mean values of some parameters regarding water quality after using different levels of thiamethoxam insecticide 30
2 Effect of thiamethoxam insecticide on growth rate of Nile tilapia 32
3 Biochemical parameter among different levels of thiamethoxam in Nile tilapia 34
4 Oxidative stress parameters among different levels of thiamethoxam in Nile tilapia 48
5 Impact of thiamethoxam insecticide on growth related,
immunity and stress genes expression in liver of Nile tilapia 63
6 ∆CT and ∆∆CT of ghrelin gene 65
7 ∆CT and ∆∆CT of TLR2 gene 66
8 ∆CT and ∆∆CT of CAT gene 67
9 Thiamethoxam residue in Nile tilapia muscles reared under
different levels 70
10 Impact of thiamethoxam insecticide on survival of Nile tilapia 72
List of Figures
Fig. Title Page
1 Mean values of some parameters regarding water quality after using different levels of thiamethoxam insecticide 31
2 Effect of thiamethoxam on growth rate of Nile tilapia 33
3 Effect of thiamethoxam on serum protein in Nile tilapia 35
4 Effect of thiamethoxam on albumin level in Nile tilapia 36
5 Effect of thiamethoxam on serum globulin in Nile tilapia 37
6 Effect of thiamethoxam on creatinine level in Nile tilapia 38
7 Effect of thiamethoxam on urea level in Nile tilapia 39
8 Effect of thiamethoxam on glucose level of Nile tilapia 40
9 Effect of thiamethoxam on ALT level in Nile tilapia 41
10 Effect of thiamethoxam on AST level in Nile tilapia 42
11 Effect of thiamethoxam on cholesterol level in Nile tilapia 43
12 Effect of thiamethoxam on TAG level on Nile tilapia 44
13 Effect of thiamethoxam on VLDL levels in Nile tilapia 45
14 Effect of thiamethoxam on HDL level in Nile tilapia 46
15 Effect of thiamethoxam on LDL level in Nile tilapia 47
16 Effect of thiamethoxam on oxidative stress parameters in Nile tilapia 49
17 Impact of thiamethoxam on growth related, immunity and stress genes expression in liver of Nile tilapia 68
18 Plot amplification for ghrelin gene 68
19 Plot amplification for TLR2 gene 69
20 Plot amplification for CAT gene 69
21 Thiamethoxam residues in Nile tilapia muscles reared under different levels of poisoning 71
22 Impact of thiamethoxam on survival of Nile tilapia 73
List of photos
Photo Title Page
1 Gill of Nile Tilapia fish of the Control group showing normal primary and secondary gill lamellae 50
2 Gill of Nile Tilapia fish of T2 group (Thiamethoxam 25 mg/l /21 days) showing lamellar lifting and congestion of branchial blood vessel 51
3 Gill of Nile Tilapia fish of T2 group (Thiamethoxam 25 mg/l /21 days) showing filamentous clubbing 51
4 Gill arch of Nile Tilapia fish of T2 group (Thiamethoxam 25 mg/l /21 days) showing eosinophilic granular cells (EGCs) infiltration and congestion of blood vessel 52
5 Gill of Nile Tilapia fish of T3 group (Thiamethoxam 50 mg/l /21 days) showing lamellar telangiectasis 52
6 Gill of Nile Tilapia fish of T3 group (Thiamethoxam 50 mg/l /21 days) showing unilateral fusion of secondary lamellae 53
7 Gill arch of Nile Tilapia fish of T3 group (Thiamethoxam 50 mg/l /21 days) showing hemorrhage 53
8 Gill of Nile Tilapia fish of T4 group (Thiamethoxam 100 mg/l /4 days) showing curved secondary lamellae 54
9 Gill of Nile Tilapia fish of T4 group (Thiamethoxam 100 mg/l /4 days) showing lamellar lifting 54
10 Gill arch of Nile Tilapia fish of T4 group (Thiamethoxam 100 mg/l /4 days) showing eosinophilic granular cells and congestion of blood vessel 55
11 Gill of Nile Tilapia fish of T5 group (Thiamethoxam 250 mg/l /4 days) showing unilateral fusion of secondary lamellae 55
12 Gill of Nile Tilapia fish of T5 group (Thiamethoxam 250 mg/l /4 days) showing lamellar lifting due to edematous separation of lamellar epithelium from capillary beds 56
13 Gill arch of Nile Tilapia fish of T5 group (Thiamethoxam 250 mg/l /4 days) showing eosinophilic granular cells 56
14 Hepatopancreas of Nile Tilapia fish of control group showing normal hepatocytes 57
15 Hepatopancreas of Nile Tilapia fish of T2 group (Thiamethoxam
25 mg/l /21 days) showing congestion of central veins 57
16 Hepatopancreas of Nile Tilapia fish of T2 group (Thiamethoxam 25 mg/l /21 days) showing diffuse hydropic degeneration of hepatocytes 58
17 Hepatopancreas of Nile Tilapia fish of T2 group (Thiamethoxam 25 mg/l /21 days) showing activation in melanomacrophage centers (MMCs) 58
18 Hepatopancreas of Nile Tilapia fish of T3 group (Thiamethoxam
50 mg/l /21 days) showing congestion of central veins 59
19 Hepatopancreas of Nile Tilapia fish of T3 group (Thiamethoxam 50 mg/l /21 days) showing sharp edge outline vacuoles of hepatocytes 59
20 Hepatopancreas of Nile Tilapia fish of T3 group (Thiamethoxam
50 mg/l /21 days) showing activation in MMCs 60
21 Hepatopancreas of Nile Tilapia fish of T4 group (Thiamethoxam 100 mg/l /4 days) showing congestion of central veins and eosinophilic granular cells 60
22 Hepatopancreas of Nile Tilapia fish of T4 group (Thiamethoxam 100 mg/l /4 days) showing destruction and necrosis of pancreatic acini 61
23 Hepatopancreas of Nile Tilapia fish of T5 group (Thiamethoxam 250 mg/l /4 days) showing activation in MMCs and congestion of blood vessel 61
24 Hepatopancreas of Nile Tilapia fish of T5 group (Thiamethoxam 250 mg/l /4 days) showing sharp edge outline vacuoles of hepatocytes 62
List of abbreviations
Abbreviations Full words
A/G ratio Albumin/globulin ratio
AAN Amino acid nitrogen
ABM Abamectin
Ach Acetylcholine
ALAT Alanine aminotransferase
ALP Alkaline phosphatase
ALT Alanine transaminase
ANOVA Analysis of Variance
ASAT Aspartate aminotransferase
AST Aspartate transaminase
BUN Blood urea nitrogen
bw Body weight
CAT Catalase
Cd Cadmium
CLO Clothiandin
CPF Chlorpyrifos
CT Cycle threshold
CYP Cypermethrin
dl deciliter
DM Deltamethrin
DO Dissolved oxygen
DO% Oxygen saturation percentage
EGCs Eosinophilic granular cells
FINAS Finasterides
g Gram
GDH Glutamate dehydrogenase
GH Growth hormone
GPx Glutathione peroxidase
GST Glutathione s-transferase
HDL High density lipoproteins
HPG axis Hypothalamic pituitary gonadal axis
HSI Hepatosomatic index
IL Interleukin
IMI Imidacloprid
IMID Imidacloprid
INF Intrinsic factor binding antibody test
ISO/IEC International Organization For Standardization /International
Electrotechnical Commission
IU International unit
Kg Kilo gram
L Liter
LCH Lamada Cyhalothrin
LDL Low density lipoproteins
LPO Lipid peroxidation
LTA Lipotechoic acid
MCP Monocrotophos
MDA Malondialdehyde
MMCs Melanomacrophage centers
mg Milligram
mM millimeter
nAChR Nicotinic acetylcholine receptors
NEFA Non esterified fatty acids
NENI Neonicotinoid insecticide
NEO Neonicotinoid
NIC Nicotine
NPN Non protein nitrogen
OXI Oxidative stress index
PGN peptidoglycan
PH Potential hydrogen
ppm Part per million
ROS Reactive oxygen species
RT-PCR Real time polymerase chain reaction
SA Serum albumin
SAS Statistical Analysis System
SD Standard Deviation
SG Serum globulin
SGR Specific growth rates
SOD Super oxide dismutase
TAC Total antioxidant capacity
TAG Triacylglycerol
TDN Total digestible nutrients
TDS Total dissolved solids
TGs Triglycerides
THX Thiamethoxam
TLR2 Toll like receptor 2
TLRs Toll like receptors
TMX Thiamethoxam
TOS Total oxidant status
U Unit
USEPA US Environmental protection agency
VLDL Very low density lipoproteins
wt Weight
μg Microgram
1. Introduction
While water is covering more than 70% of the planet and about 30% of mankind suffering from malnutrition, aquatic foods are considered a vital part of the world food storage that may improve all people’s general health, nutrition, and well-being (Tacon and Metian, 2013). Besides, as a healthy food, fish such as finfish, crustaceans and molluscs, represents an important part of human nutrition, accounting for at least 20% of protein consumed by a third of population in the world, with the maximum dependence observed at developing countries (Béné et al., 2007).
However, the Nile tilapia Oreochromis niloticus (L.) is found to be among fish species that are mostly cultured around the world, besides it is considered among of the most widespread invasive fish species in the world (Gu et al., 2017). Additionally, species of Tilapia are preferred in fish farming as they can reproduce quickly after birth, have flexible life requirements, are resistant to a variety of environmental circumstances, and develop quickly (Grammer et al., 2012; Gu et al., 2014).
Obviously, frequently pesticides are used in agriculture sector around the world to increase the output of the crops with little use of labor and efforts (Ullah and Zorriehzahra, 2015), in spite of this, they are able to persist in the ecosystem throughout time (Nordborg et al., 2017). Moreover, numerous pollutants of the environment mainly pesticides and heavy metals have been related to negative impact including abnormalities in spermatogenesis, inadequate fertilization, apoptosis, DNA fragmentation and mitochondrial dysfunctions in humans and other organisms as a result of ROS-scavenging antioxidants inhibition (Khan et al., 2015; Ghaffar et al., 2017).
Additionally, exposure to pesticides can cause adverse impacts in a variety of nontargeted creatures with fish being one of the most notable among them (Ullah and Zorriehzahra, 2015). Unfortunately, fish are susceptible to water pollutants among all aquatic vertebrates. Furthermore, different toxicants can cause physiological and biochemical alterations in the fish as they are up taken through the skin, gills or gastrointestinal tract particularly and distribute into various fish tissues (Ghaffar et al., 2021).
For Campos-Garcia et al. (2015), areas used for fish and other aquatic organisms farming are frequently subjected to water polluted by agrochemicals as these areas are close to fields where vegetables are grown and treated with these chemicals. In addition, as a result of the wide application of these chemicals, they are able to reach surface waters through spray drift or surface runoff (Ding et al., 2019).
In 1980s, Neonicotinoids were regarded as the only significant novel class of insecticides that were used to control large number of pest populations, besides, they are the most recently developed insecticides class to be improved (Stoyanova et al., 2016). Moreover, somewhat neonicotinoids are soluble in water (e.g. Thiamethoxam 4.1 g/L) and they can leech into close water bodies (Tišler et al., 2009).
Second-generation of neonicotinoids as clothianidin (CLO) and thiamethoxam (THM) were introduced by Sumitomo Chemical/Bayer and Syngenta, respectively, in the early 2000s (Jeschke et al., 2011). Recent evidences suggested that throughout the world, thiamethoxam is regarded as the most frequently used neonicotinoid insecticide. In fact, extensive use of thiamethoxam has led to detection of its residues in water, causing an adverse latent impact on the aquatic creatures’ life (Zhou et al., 2019).
Thiamethoxam (THX) is a commonly used neonicotinoid insecticide in agriculture in order to manage a wide range of sucking and chewing pest insects (Finnegan et al., 2017). To control pests, thiamethoxam interferes with neurotransmission by acting on the receptors of nicotinic acetylcholine (ACh) in the central nervous system of the insects (Zhang et al., 2021). Obviously, Clothianidin which is produced from thiamethoxam inside organisms is more active than the original molecules (Shi et al., 2009). Furthermore, because of the little differences in chemical structure of thiamethoxam from other members of neonicotinoid insecticides, it is considered as the most water soluble of this family (PĂUNESCU et al., 2010).
The insecticide Actara 25 WG that has an active ingredient (thiamethoxam 25%) was approved for use on seeds, leaf surfaces and the ground to prevent a variety of pests, such as aphids, white butterflies, cuttlefish and some cockroaches species (Maienfisch et al., 2001). Surface runoff, groundwater leaching and spray-drift are the ways by which thiamethoxam can reach aquatic environments leading to negative impacts on the aquatic life, involving fish (Valavanidis, 2018).
Generally, neonicotinoids intoxication results in mutagenic and carcinogenic changes (Karabay and Oguz, 2005). Moreover, it was stated that THM leads to immunotoxicity, oxidative stress, hepatorenal damage, hemato-biochemical changes and metabolic abnormalities mainly in fish (Salbego et al., 2020).
Various indices including reproduction, growth and survival of aquatic organisms are also adversely affected. Similarly, Hussain et al. (2022) found that fresh water fish subjected to sublethal concentrations of thiamethoxam experienced alterations in serum biochemistry, DNA damage histopathological changes. In addition, it was reported that toxic impacts induced by pesticides on fish occur through elevating the reactive oxygen species (ROS) levels (Temiz et al., 2021).
As well, it was reported that reproductive capacity of fish is adversely affected by pesticides leading to sexual developmental abnormalities, male feminization, changes in sex ratio, and abnormal mating behavior (Jenkins et al., 2003). Furthermore, synaptic transmission disruption in the nervous system of fish results inneurological disorders and systemic neurotoxicity (Hladik et al., 2018).
There was a dramatic increased damage of the DNA in liver, kidneys, and blood cells detected by comet assay in Labeo rohita (Hussain et al., 2022). Undoubtedly, marked changes in fish hemato-biochemical indices, histopathology, and immune profile serve as vital biomarkers in toxicological investigations mainly in pesticides toxicity (Vali et al., 2022).
Although thiamethoxam toxic impacts have been studied in several researches but we know little about its impact on Nile Tilapia specially, so exclusively, this study aimed to estimate the adverse effects of water polluted by thiamethoxam insecticide on Nile tilapia health condition through of the following:
1. Evaluation of some water quality parameters.
2. Evaluation of productive performance of fish.
3. Evaluation of some biochemical indices in serum including;
• Total protein, albumin and globulin • Glucose and cholesterol levels.
• Liver and kidney functions.
• Oxidative stress biomarkers including superoxide dismutase, malondialdehyde and total antioxidant capacity activities.
4. Detection of histopathological alliterations that have occurred in liver and gills of fish.
5. Application of Real time PCR technique for detection of growth related, stress and immunity genes in liver tissues of fish.
6. Determination of pesticide residues concentration inside fish flesh.
7. Determination of Fish mortalities.
2. Review of literatures
2.1. Fish farming:
2.1.1. Value and importance of fish farming:
Onada and Ogunola (2017) mentioned that fish farming around the world has developed significantly to be economically an important business in last 20 years. In comparison with all animal food producing industries, aquaculture keeps growing with an average world yearly growth level of 8.8 percent every year.
Bouelet Ntsama et al. (2018) stated that fish has long played a main role in the diets of people in different areas of the world. For the majority of the economically disadvantaged socioeconomic strata, fish provides people with minerals, vitamins, proteins and unsaturated essential fatty acids.
Galappaththi et al. (2020) cleared that the industry that produces the most food at the quickest rate of growth is fish aquaculture, which makes over 50% of all fish produced worldwide. Globally, 424 aquatic species are cultivated, which benefits millions of people by reducing poverty and promoting food security, nutrition, and sustainable livelihoods.
Tacon (2020) mentioned that there were 53.4 million tonnes of fish recorded in 2017, with a value about US$ 139.7 billion. Since 2000, fish output has increased at an average yearly rate of 5.7% annually. Fish production has been reported from over 208 distinct species. Furthermore, whereas freshwater fish species accounted for over 83.6% of fish produced, compared to just 13.4% from capture fisheries, our world is covered with over 70% marine or brackish water.
FAO (2020) reported that aquaculture encompassed the cultivation of a variety of aquatic plants and animals; however it is always associated with fish farming. Among the species frequently selected for aquaculture are fish, mollusks, crabs, seaweed, and others. Aquatic species including fish are cultivated in both freshwater and marine environments.
Rocha et al. (2022) assumed that global production has grown from 0.6 million metric tons in 1950 to 120 million metric tons in 2019.
2.1.2. Aquaculture industry in Egypt:
Soliman (2017) pointed out that Egypt’s aquaculture industry, which is the hugest in Africa, recently is regarded as the main fish provider, with overall amount of output about 1.8 million tons. With regard to this, aquaculture of fish has grown quickly from 0.54 million tons in 2005 to 1.23 million tons in 2015 because of rapid development of new technologies applied such as the use of extruded feed, water circulation systems, and enhanced farm management practices.
Feidi (2018) mentioned that Egypt is the greatest producer of aquaculture in Africa, making up 73.8 percent of the continent’s total aquaculture volume and 64.2 percent of its total aquaculture value. Egypt is ranked also as world’s seventh-biggest producer. A total of 1.5 million tonnes in 2015 was Egypt’s total fisheries output from all sources (marine, freshwater, and aquaculture), from which 1.2 million tonnes came from aquaculture (78%) and 336,000 tonnes from capturing as inland and marine fisheries (22%).
Shaalan et al. (2018) supposed that, Egypt has practiced aquaculture for thousands of years, but only recently new approaches have been adopted to increase its output. Today, the hugest aquaculture production in Africa is Egypt, with nearly one million tonnes annually.
Hassan et al. (2019) clarified that fish farming is a useful provider of high-quality protein. The value of fish produced in 2016 was LE 20 billion, or almost 9.5% of the overall agricultural revenue of 209.9 billion pounds. Egypt’s fish culturing is the primary source of fish production, making nearly 73.3% of the country’s total fish output in 2016. Fish from all other natural water sources, such as lakes, seas, and the Nile River with its branches, accounted for around 391.8 thousand tonnes, or 26.7% of the total fish output.
Shehata and Eldal (2022) mentioned that fisheries have seen an impressive growth in the use of fish as a protein source compared to other animal protein sources, particularly for low-income populations. from 2001 to 2018, the consumption of the average per capita has increased from approximately 15.8 kg/year in 2001 to approximately 21 kg/year in 2018, representing a rate of increase approximately 32.9%. The growth rate per year reached around 5.4%.
2.1.3. Significance of cultivation of Nile tilapia:
Kumar and Engle (2016) stated that Nile tilapia that lives in warm water is among the most significant fishes used in aquaculture.
Boonanuntanasarn et al. (2018) clarified that various systems for culturing can be attributed for farming tilapia, as Nile tilapia are characterized by fast-growth, the ability of adaptation in various environmental conditions, capability of small ponds reproduction and artificial feed consumption from the primary feeding stage ability.
El-Sayed (2020) showed that, Nile tilapia, usually represented as the ‘aquatic chicken’, can be considered as an economic fish when compared to other cultured fish, which consume higher trophic levels. So, in many times, it is considered as a food for low income individuals, or the fish for the masses.
FAO (2020) reported that the third main cultivated fish species in the world was the Nile tilapia, exceeding Cyprinus carpio production, the common carp and this growth in production ended in a steady rise in the rate of per capita of tilapia consumption in recent years.
El-Sayed and Fitzsimmons (2023) clarified that farming Nile tilapia is leaded in Africa by Egypt in 2019, which made 84% to Nile tilapia farming output in Africa. Also, they added that Egypt is considered the third one in the top producers of Nile tilapia in the world, after China and Indonesia.
2.2. Pesticides:
Pesticides contaminated surface waters is known to have negative impacts on the reproduction, survival and growth of aquatic animals. Different concentrations of insecticides are found in various types of waste water and numerous studies have found them to be toxic to aquatic organisms, particularly fish species (Sabra & Mehana, 2015).
2.2.1. Chemical classification and mode of action:
Thiamethoxam [3-(2-chloro-1, 3-thiazol-5-methyl) −5–methyl -4nitroimino - perhydro-1, 3, 5-oxadiazine] is classified as a neonicotinoid insecticide of second generation one, which act against a wide variety of commercially important pests whether they are sucking or chewing (Green et al., 2005 and Thany, 2010).
In comparison with other neonicotinoids, Van Dijk et al. (2013) reported that thiamethoxam was the most efficient pesticide as it had a unique ability of binding irreversibly with post synaptic nAChR.
Bass et al. (2015) mentioned that the global thiamethoxam sales in 2012 reached US $1.1 billion, which represented about 37.6 % of the overall neonicotinoid insecticides market share.
Albinati et al. (2016) mentioned that the insecticide thiamethoxam, which is a second generation neonicotinoid, belongs to toxicological classification III (medium toxicity) and environmental class III (environmentally dangerous).
Gul et al. (2017) pointed out that thiamethoxam, which is applied extensively in agriculture sector for controlling leafhoppers, whiteflies, and aphids, is a thianicotinyl subclass of neonicotinoid (NEO) insecticides.
Ihara and Matsuda (2018) mentioned that neonicotinoid insecticides (NENIs) including imidacloprid, thiamethoxam and clothiandin are commonly used in agricultural and urban places.
Moreover, neonicotinoids are mimics of acetylcholine, they are agonists for nicotinic acetylcholine receptor (nAChR), which successively stimulate the activity of cholinergic receptors, ends in hyper-excitation and insects death, In addition, they bind with receptors inside the central nervous system (CNS) of the organisms tightly (Casida, 2018).
Wang et al. (2019) claimed that androgen inhibition in male lizards could be resulted from thiamethoxam, whereas in female lizards, the expression of the hsd17β gene was upregulated in ovaries caused by thiamethoxam that resulted in plasma testosterone level increase with an increase in liver androgen receptor expression.
2.2.2. How thiamethoxam reaches water bodies?
Due to increased water solubility of thiamethoxam, Barbosa et al. (2016) supposed that it can be easily released from agricultural regions into the environment during its use, particularly after storm events.
Pesticides have various ways through which they can eventually find their way into aquatic environment as spray drift, run off and leaching (Shahjahan et al., 2017).
According to Borsuah et al. (2020), thiamethoxam half-life is 385-408 days in water and 6-3001 days in soil.
2.2.3. Harms conflicted upon fish due to exposure to thiamethoxam:
Bose et al. (2011) detected a marked lowering in growth and liver total protein in Nile tilapia as a result of thiamethoxam intoxication. Also, there is a strong relationship between O. niloticus’ hematological profile and thiamethoxam doses.
Nath et al. (2012) detected that O. niloticus to intoxication by a sublethal dose of thiamethoxam (>12.5 mg/L) affects liver total protein after 7 and 14 days markedly.
Stoyanova et al. (2016) mentioned that fish are sensitive to thiamethoxam water pollution.
Yan et al. (2016) mentioned that Thiamethoxam exposure induced damaging of DNA that detected by comet assay in Zebra fish liver at 0.30, 1.25, and 5.00 mg/L.
Baldissera et al. (2018a) demonstrated that a potential neurotoxicity was induced as a result of thiamethoxam exposure through targeting the brain purinergic signaling in silver catfish.
Baldissera et al. (2018b) claimed that the activity of cytoplasmic and mitochondrial creatine kinase severely impaired by Thiamethoxam exposure in both cytoplasm and mitochondria, besides it damaged the energy balance of cells, leading to oxidative stress.
Ghaffar et al. (2020) reported that pesticides at sublethal concentrations in aquatic environment results in metabolic abnormalities, behavioral changes and aquatic organisms’ death.
Temiz et al. (2021) clarified that a clear toxic impact was induced by pesticides on fish through rising of the reactive oxygen species amount.
Hussain et al. (2022) noticed that when thiamethoxam used at sublethal concentrations (0.5–2 mg/L), it led to serum biochemical and histopathological changes with DNA damage in freshwater fish.
Yang et al. (2023) observed that an enhancement in aggregation, locomotor and social activity of in adult Zebra fish after thiamethoxam exposure, but there was disruption in memory of the food zone with abnormalities in swimming behavior. Also, they added that exposure to thiamethoxam could lead to infiltration of erythrocytes, cloudy swelling, brain tissue necrosis, and other pathological alterations in tissues of the brain. Also, it affected the levels of both acetyl cholinesterase and cortisol related to the neurotoxic impacts.
2.3.1. Effects of thiamethoxam on water quality:
Firstly, water quality is considered chemical, physical, biological and radiological parameters of water. Decreased levels of dissolved oxygen (DO) is supposed to be a key reason for poor appetite, stress, reduced growth rate, sensitivity to diseases and increased mortalities in aquatic vertebrates. However, increasing pH causes alterations in processes of ion-exchange by gills causing a reduced capacity of osmoregulation, a rise in blood alkalosis with a decrease in ammonia excretion gradient through the gills into the adjacent water (Mwegoha et al., 2010 and Eruola et al., 2011).
Additionally, Boyd (2017) pointed out that there was a close relationship between aquatic animals health conditions and grow-out systems water-quality parameters, so any impairment in water quality can results in mortalities directly, but mostly, it increases susceptibility of infectious diseases through induction of stress in aquatic organisms.
Lobson et al. (2018) demonstrated that regarding water quality parameters, there was no significant difference before and after thiamethoxam application so they were not affected by the use of thiamethoxam. They observed during sampling days that there were significant differences in conductivity, pH, DO, TDN, hardness, temperature and alkalinity.
These results were detected when 0, 25, 50, 100, 250, and 500 μg/L of thiamethoxam were applied and monitored for 8 weeks.
Hasan et al. (2021) concluded that dissolved oxygen dramatically decreased by increasing thiamethoxam concentration and duration in water whereas no detected variations were observed for pH and temperature. Thiamethoxam was added to water by different doses (9.37, 18.75, 37.5, 75 and 150 mg/L) for 60 days during this duration water quality indices (e.g. temperature, DO and pH) was measured every 15days for detection of any change occurred.
Phillips et al. (2022) used three pesticides with different concentrations to evaluate their effect on dissolved oxygen (DO) in water. Methyl (244 µg/L, 266 µg/L and 92.1 µg/L), Clothianidin (4.89 µg/L, 2.11 µg/L and 1.15 µg/L for 96-h LC50, 10-day LC50 and 10-day IC25) and THX (56.4 µg/L, 32.3 µg/L and 19.6 µg/L) were added to water then dissolved oxygen was measured. Their findings revealed that dissolved oxygen levels of the 10-days experiment reduced below the optimum 2.5 mg/L threshold. Furthermore, higher pesticide levels resulted in lower oxygen concentrations.
2.3.2. Impact of thiamethoxam on fish growth:
Sweilum (2006) found that, dimethoate (20, 10 and 5 mg L−1) and malathion (2.0, 1.0 and 0.5 mg L−1) sublethal doses have made toxic effects on Nile tilapia, as there was a dramatic reduction (P<0.05) in specific growth rate, final body weight and fish normalized biomass index. On the other hand, these pesticides decreased fish survival rate with raising pesticides levels. Pesticides treatments affected the utilization of feed (feed conversion ratio, total food consumed and protein efficiency ratio) variably.
Gibbons et al. (2015) recorded that as imidacloprid, clothianidin and fipronil were not a cause of mortalities mainly among adults, these pesticides intoxication, can result in growth, development and reproduction reduction of individual vertebrates.
Chagnon et al. (2015) suggested that the higher the neonicotinoids levels in water bodies, the higher the alterations in the ecosystem functions occur regarded to the transmission of nutrients from primary producers to secondary consumers, leading to lowering of survival rates, growth, and reproduction in freshwater organisms, including fish and other water insects.
Velisek and Stara (2018) conducted an experiment to evaluate the toxicity of thiacloprid on the embryos and larvae common carp intoxicated with various concentrations of the insecticide: 4.5, 45, 225, and 450 μg/L for 35 days and a non-exposed control group. By the end of the study, carp subjected to 45 μg/L thiacloprid experienced a reduction in weight and length in comparison to non-treated group. In addition, use of 225 and 450 μg/L thiacloprid resulted in reduction in both fish weight and length.
Zhu et al. (2019) observed that when Chinese rare minnow was subjected to thiamethoxam at 0, 0.5, 5, and 50 μg/L for 90 days, there was a dramatic reduction in body length at 50 μg/L, while weight and hepatosomatic somatic index (HSI) increased significantly at 0.5 μg/L in males. Meanwhile in females, the body length was lowered in all intoxicated groups and there were non-significant changes in other parameters, including HSI and weight.
Dawood et al. (2020) proved that deltametherin intoxicated Nile tilapia exhibited a dramatic reduction in survival rate, weight gain, final body weights and specific growth rate (SGR), when they were intoxicated by subacute dose of deltametherin (15 μg/L) for 30 days.
Abdel-Tawwab et al. (2021) monitored Nile tilapia growth performance when exposed to 0.0 or 0.05 μg /L imidacloprid (IMI) for 8 weeks and found a marked decrease in the parameters of growth when compared to control one.
Hossain et al. (2022) suggested that when chlorpyrifos insecticide levels increased, SGR, weight gain and survival rate of O. niloticus were reduced as they were exposed to various chlorpyrifos doses for 60 days.
2.3.3. Effect of thiamethoxam on serum biochemical indices:
Shahjahan et al. (2022) suggested that hemato-biochemical parameters are a beneficial means to evaluate the effects of various pollutants to determine the fish health condition.
Kumar et al. (2010) mentioned that at thiamethoxam sublethal doses, biochemical indices in the serum of the fresh water fish, Channa punctuatus could be adversely affected, as there was an elevation in glucose, amino acid nitrogen (AAN), creatine, lactate, urea, bilirubin, tri acyl glycerol and non-esterified fatty acids (NEFA) and phospholipids levels, in contrast, the levels of protein, pyruvate, non-protein nitrogen (NPN) and albumin were decreased at different time intervals during the toxic exposure periods in the fish serum.
Ilahi et al. (2018) exposed grass carp and golden fish to 2 mg/l of imidacloprid for 28 and 24 days, respectively. They observed that albumin level in the serum was markedly lowered in the intoxicated groups of both fish species when compared to the control. Level of serum globulin in grass carp was insignificantly low however it was significantly low in golden fish. Moreover, the level of total proteins in serum of the either fish species was insignificantly lower related to control groups.
Vieira et al. (2018) argued that there was a substantial decrease of blood glucose in Prochilodus lineatus fish at different levels of imidacloprid (1.25, 12.5, 125, and 1250 μg L−1) for 120h revealing that there was an increase in energetic demands.
Américo-Pinheiro et al. (2019) observed that the level of total plasma protein in Nile Tilapia subjected to 14.050 and 28.1 mg/l of IMI, markedly decreased when compared to non-intoxicated group of fish.
Albinati et al. (2020) carried out a study to evaluate the toxicity of a thiamethoxam on Nile tilapia intoxicated by 32 mg/ L for 24, 48, 168, and 360 hours. They found that there was a lowering in the total protein with increased triglyceride levels of the treated one compared to the control. However, other indices didn’t show any differences between the exposed and control fish.
Veedu et al. (2022) detected a reduction in plasma protein levels in case of using individual and binary mixtures of acetamiprid and thiamethoxam for 96 h. In contrast, blood glucose level of all treatments increased significantly in a study performed on individual and mixed toxicity of acetamiprid and thiamethoxam in a freshwater fish Catla catla.
Mukherjee et al. (2022) recorded that Clarias batrachus experienced a marked rise in serum protein and globulin in contrast to serum albumin activity which was decreased at sublethal doses (6.93, 13.86 mg/l) of thiamethoxam at all exposure durations (15d, 30d, 45d). However, both triglycerides and glucose levels raised significantly at both the chronic doses (6.93 and 13.86 mg/l) of thiamethoxam in all exposure durations.
Desai and Parikh (2013) subjected O. mossambicus and Labeo rohita, to 21days sublethal doses of IMI and detected significant disruptions in various biochemical indices including; ALT, AST, ALP, and GDH. They explained that the increase of activities of these enzymes in fish tissues indicated liver damage that was linked to imidacloprid exposure.
Stoyanova et al. (2016) exposed bighead carp fish to 6.6 mg/l, 10 mg/l and 20 mg/l of thiamethoxam and observed that the activity of LDH, ALAT and ASAT showed an increase at all investigated concentrations.
El-Euony et al. (2020) subjected African catfish to thiamethoxam (5 mg L−1) for 1 month. Results showed an exceptional elevation of serum markers of hepatorenal injury such as ALT, ALP, AST, blood urea nitrogen (BUN) and creatinine levels of activity while there was a significant reduction of serum protein levels in TMX treated group.
Abdel-Tawwab et al. (2021) exposed Nile tilapia to imidacloprid (0.05 μg/L) and observed substantial high levels of aspartate and alanine aminotransferase, urea, alkaline phosphatase and creatinine in serum.
Mukherjee et al. (2022) carried out an investigation on Clarias batrachus fish subjected to different levels of thiamethoxam (6.93 and 13.86 mg/l) and the toxic impacts were determined at 15, 30, and 45days exposure intervals. On assessment of liver function test, a marked elevation was observed in cholesterol, HDL, LDL and VLDL levels was observed at both chronic doses.
Hussain et al. (2022) made an investigation on different groups of freshwater fish Labeo rohita exposed to 21h sublethal doses of thiamethoxam (0, 0.5, 1.0, 1.5, and 2.0 mg/L) to determine the possible genotoxic and serum biochemical implications. Significant raised concentrations of urea and creatinine were detected in thiamethoxam intoxicated fish. Also, the levels of liver function tests (AST, ALT and ALP) and function tests of the heart (cholesterol, triglycerides) were significantly increased.
2.3.4. Biochemical Oxidative stress markers:
Jin et al. (2010) stated that the inhibition of oxidative stress depends mainly on antioxidant enzymes (SOD, CAT, GPx and GST) as well as actions of these enzymes are monitored frequently to detect the risk of pesticides. In addition, Modesto and Martinez (2010) mentioned that malondialdehyde (MDA) is the final output of lipid peroxidation and this can be resulted when antioxidant defenses are not sufficient enough to prevent the excessive ROS that may be produced during the biotransformation reactions.
Yan et al. (2016) carried out a study on thiamethoxam (0.30, 1.25, and 5.00 mg/L) toxic impact on Zebra fish livers after 7, 14, 21, and 28 days. They concluded that ROS levels were elevated during the treatment period; a dramatic increase in SOD and CAT activities during the start of exposure and then prevented. GST level was only raised on 28 days. MDA activity experienced a slight increase on days 21 and 28.
Kocamaz and Oruc (2018) performed an investigation on thiamethoxam and lambda cyhalothrin synergistic impact on total oxidant status (TOS), oxidative stress index (OXI), total antioxidant capacity (TAC) and liver proteins, brain and gonad tissues of Nile tilapia. The fish exposed to7 and 15 days individual and mixed doses of thiamethoxam (1/20, 1/10 of 96h LC50) and lambda cyhalothrin (477.29 mg/L, 2.901 µg/L). Results showed an elevation in OXI and TOS while TAC levels were reduced in tissues.
Günal et al. (2019) subjected Nile Tilapia to sublethal levels of imidacloprid (50 and 100 mg/l) for 24 and 96 hr. By oxidative stress biomarker examination in both liver and gills tissues, there was a dramatic rise in MDA during all treatments in liver and gill tissues (except the low level of 24 h). Liver levels of SOD and glutathione peroxidase reduced at both concentrations and exposure durations, except for its increase at the 96 h high dose.
A study carried out by El-Garawani et al. (2021) for 21 days on two groups of
Nile tilapia that were subjected to sub-lethal doses of Imidacloprid (8.75 ppm, 1/20 of 72hLC50 and 17.5 ppm, 1/10 of 72h-LC50). They found that imididacloprid exposure resulted in significant (p˂ 0.05) changes in fish antioxidant profile of liver by elevating the activities and gene expression of SOD, CAT and GPX as well as ascending the levels of LPO. In an experiment on Nile Tilapia, exposure of fish to 50, 100, and, 150 mg/L of thiamethoxam for 48 h and 15 days was performed.
Temiz et al. (2021) observed that in liver and brain tissues, there was a dramatic reduction in levels of CAT and GSH, in addition to an elevation of SOD levels.
Hathout et al. (2021) suggested that, when juveniles of Nile tilapia exposed to 10 and 20 ppm acetamiprid (Aceta) for 21days, antioxidant enzymes activities (SOD and GPX) were dramatically reduced in fish exposed to 10 and 20 ppm of Aceta when compared to control. However, CAT levels showed a non-significant elevation among both Aceta-exposed groups.
2.3.5. Histopathological alliterations due to thiamethoxam toxicity in fish:
2.3.5.1. selection of gills and liver for toxicity detection:
Gardner et al. (2001) supposed that gills represent the main site for most water pollutants uptake as well as they were thought to be affected first by many of these toxic pollutants. In addition, gills are responsible for performing essential physiological processes besides they are sensitive to both structural and biochemical alterations of the branchial epithelium. Furthermore, Liver primarily plays a key role in biotransformation reactions, also it is indicated as an important organ in xenobiotics detoxification and accumulation of contaminants, due to this it is regarded as a helpful biomarker for toxicity assessment (Calitz et al., 2018; Nithyananthan and Thirunavukkarasu, 2019).
Huang et al. (2020) reported that in aquatic vertebrates, the gill serves as a primary mucosal immune organ, and fish healthy growth is closely related to the structural integrity of the gill. However, Zhang et al. (2023) reported that liver choosing as a target organ for performing studies helps to gain a deep knowledge of different aspects of fish physiology, health, and adaptability.
2.3.5.2. Gills histopathology:
Georgieva et al. (2014) investigated the impact of thiamethoxam on the histological structure of common carp gills. Fish subjected to 6.6, 10 and 20 mg/l thiamethoxam. Findings revealed various histopathological changes in the epithelium of the gills, which included lamellar lifting, edema, proliferation of the glandular cells and epithelium covering the gill filament, fusion and degenerative alterations besides the blood circulatory system vasodilatation. After 24 and 96 h of Nile Tilapia exposure to sub-lethal imidacloprid concentrations (50 and 100 mg/l), scarification of fish with gill tissues examination under microscope revealed epithelial lifting, fusion of secondary lamellae, hyperaemia and telangiectasia (Günal et al., 2019).
El-Euony et al. (2020) conducted a study on African catfish exposed to thiamethoxam (5 mg L−1) for 1 month. By histopathological examination of the gills, tissues revealed epithelial lifting and hyperplasia of the primary lamellae with multifocal partial or complete lamellar fusion, diffuse fusion of the secondary lamellae with epithelial lifting, hyperplasia of goblet cells, beside lamellar and filamentous epithelial cells necrosis and desquamation with edema, inflammatory cell infiltrations, and hemorrhage.
A study performed by Ghaffar et al. (2020) on fresh water fish (Labeo rohita), in this study fish were exposed to various concentrations of Thiamethoxam (0, 0.5, 1.0, 1.5 and 2.0 mg/l) for 120 hr. Microscopic analysis of gill tissues of different experimental fish exhibited atrophy of secondary lamellae, pyknosis of lamellar epithelial pillar cells, lamellar degeneration, congestion, aneurysm and curling of lamellae.
El-Garawani et al. (2022) conducted a study to examine the side effects of selected neonicotinoids (acetamiprid, Aceta, and imidacloprid, Imid) on Nile tilapia juveniles. Fish were exposed to 1/10 of the LC50 of both neonicotinoids for 21 days. Fish gills from the Aceta group (19.5 ppm) showed severe histopathological changes, the gills were edematous and suffered from hyperplasia, hemorrhage, and fusion of the secondary lamellae. However, fish gills from the Imid-exposed group (15 ppm) severely showed a serious of histopathological changes, such as the dilatation of congested capillaries, hyperplasia and increased thickness of the epithelium of gill lamellae.
2.3.5.3. Liver histopathology:
Ansoar-Rodríguez et al. (2016) performed an investigation on Liver tissues collected from O. niloticus exposed to 250, 125 and 62.5 mg/l of imidacloprid for 96h. By microscopic examination, hydropic degeneration, pyknotic nucleus, cytoplasmic vacuolations and loss of cell limits were noticed. Hyperemia, mononuclear cell infiltration, hepatocytes vacuolization and hydropic degeneration were observed under microscope.
In an experiment on African catfish, fish were exposed to THX (5 mg L−1) for 1 month. Liver tissues experienced pathological changes including, vacuolation of hepatocytes which is hydropic and fatty one associated with pyknotic and eccentric nuclei, necrosis of hepatocytes with mononuclear cells and perivascular mononuclear cell infiltrations, hemorrhage and marked activation of MMCs (El-Euony et al., 2020).
Hasan et al. (2023) conducted a study to investigate the effect of thiamethoxam insecticide on liver tissue of Banded Gourami (Trichogaster fasciata). Fish were subjected to 9.37, 18.75, 37.5, 75, and 150 mg/L of Thiamethoxam for 90 days and by histopathological assessment of liver tissues of different groups, there was fatty degeneration, acute cellular swelling, autolysis, vacuolation and necrosis.
2.3.6. Application of Real Time PCR technique for detection of growth, immunity and stress genes:
2.3.6.1. Growth related genes (gherlin):
Unniappan and Peter (2005) suggested that, ghrelin which was described as the 1st recognised endogenous ligand of the growth hormone secretagogue receptor, was purified originally in rats and humans. Moreover, it is a peptide hormone that results in controlling of a number of physiological functions like releasing of pituitary hormones and stimulating food intake in fish.
According to Fox et al. (2009) ghrelin which is secreted by the stomach, is a highly conserved hormone involved in food intake and energy expenditure regulation. Growth hormone (GH) release was stimulated by ghrelin release with increasing the appetite in different types of vertebrates, including various fish species.
Furthermore, the GH-secretagogue (ghrelin) receptor is a typical Gprotein-bound receptor found in several species of aquatic vertebrates. However, the hypothalamus, pituitary, brain, alimentary tract, and liver are considered sites for GHS-R mRNA detection in most fish species although the precise tissue distribution differs (Chan and Cheng, 2004; Jönsson, 2013).
Additionally, ten years ago ghrelin was detected firstly in fish as a hormone of beneficial roles in the food intake and metabolism regulation. According to Jönsson (2013), exposing O. niloticus and goldfish to ghrelin treatment results in food intake increase with stimulation of lipogenesis and tissue fat deposition which accounted for a more positive energy state in fish.
Moreover, Zhong et al. (2021) supposed that, ghrelin which is mainly secreted in gut, is a peptide hormone involved in variable physiological body functions. Processes like growth, food intake, energy balance, and reproductive process can be controlled by ghrelin hormone. Suggestive recent evidences revealed that ghrelin is also associated with hypothalamic– pituitary–gonadal axis (HPG axis) and enters in regulation of gametes maturation.
2.3.6.2. Impact of thiamethoxam on ghrelin expression:
Sánchez-Bayo and Goka (2005) suggested that imidacloprid insecticide dramatically reduced both weight and length of Japanese medaka fry when treated with Admire GR (1% imidacloprid) at a rate of 215 g a.i./ha. This treatment is conducted in two fields contained rice seedlings; in addition, the used dose is about 1.5 times the optimum application rate on commercial rice fields.
Furthermore, Lal et al. (2013) supposed that catfish experienced a reduction in the levels of growth hormone (GH) and thyroxine (T4) when fish are subjected to malathion at 0.001 ml/liter and 0.0001 ml/liter.
In contrast, Marlatt et al. (2019) found that clothianidin had no significant impact on expression of growth genes of embryonic, alevin and early swim-up fry sockeye salmon (Oncorhynchus nerka) after a 4months experiment by using different clothianidin treatments (0.15, 1.5, 15 and 150 μg/L).
Furthermore, Vignet et al. (2019) observed that imidacloprid resulted in sublethal impact on Zebrafish and Japanese medaka, although in medaka the impact was much stronger with decreased growth, deformities and lesions were the most observed effects. In this study, imidacloprid was applied at various concentrations from 0.2 to 2000 μg/L for 5 (zebrafish) and 14 (medaka) days through aquatic exposure.
According to Victoria et al. (2022), there was an observed impairment in hatching and growth of zebrafish in early life after chronic exposure to different concentrations of thiamethoxam (TM) or nicotine (NIC) at ≥0.21 µg TM/l or 4.9 µg NIC/l while performing a study on the effect of both chemicals on fish health.
On the contrary, Abdel Rahman et al. (2023) detected a significant reduction (p < 0.05) in growth, economic value, acetylcholine esterase, glucose concentration and antioxidant capacity of African catfish (Clarias gariepinus) subjected to imidacloprid (1/5 LC50: nominal 2.03 μg/L) and sampled after 2 months of intoxication.
2.3.6.3. Oxidative stress gene expression (catalase):
Gayashani Sandamalika et al. (2021) mentioned that catalase which is an important enzyme in the antioxidant defense mechanism of organisms, scavenges free radicals to prevent their harmful impacts on the host with proper immune function support.
2.3.6.4. Impact of thiamethoxam on catalase expression:
Tian et al. (2018) observed a marked reduction in catalase expression levels (p < 0.05) of juvenile Chinese rare minnows under 0.1 and 0.5 mg/L nitenpyram intoxication. This result was observed when fish were subjected to 0.1, 0.5 and 2.0 mg/L of imidacloprid and nitenpyram for 60 days to study their toxic effect on the brain of juvenile Chinese rare minnows.
Furthermore, Qi et al. (2018) conducted a study to evaluate the effect of three neonicotinoid insecticides (cycloxaprid (CYC), guadipyr (GUA) and imidacloprid (IMI)) on Daphnia magna, aquatic flea. They were intoxicated by sub lethal concentrations of IMI, CYC and GUA (1.25, 2.5, and 5.0 mg/L) for 48h. Results showed that, catalase gene expression was markedly downregulated by IMI and GUA, although it was up-regulated by CYC.
Tian et al. (2020) found a dramatic down regulation of catalase gene expression in 0.1 and 0.5 mg/L nitenpyram and 0.5 mg/L dinotefuran (0.59-, 0.53- and 0.59-fold, respectively; p < 0.05) intoxicated juvenile Chinese rare minnows when they were exposed to 0.1, 0.5, or 2.0 mg/L neonicotinoid insecticides (imidacloprid, nitenpyram, and dinotefuran) for 60 days.
El-Garawani et al. (2021) carried out a research on Nile tilapia (Oreochromis niloticus) exposed to different concentrations of imidacloprid. Fish were subjected to 8.75 ppm, 1/20 of 72 h-LC50 and 17.5 ppm, 1/10 of 72 h-LC50 of imidacloprid for 21 days. Results revealed marked disruption in the antioxidant profile of the imididacloprid intoxicated fish livers with an increase in the expression and activities of SOD, CAT and GPX as well as an elevation in the concentrations of LPO.
In addition, Ahmed et al. (2022) supported the previous results by finding a significant down regulation of the antioxidant enzymes (sod and cat) gene expression in Nile Tilapia liver when fish exposed to 1/5 of atrazine (herbicide) 96-h lethal concentration 50 (1.39mg/l).
2.3.6.5 Immunity genes (TLR2):
According to Samanta et al. (2012) Toll-like receptors (TLRs) are among the valuable constituents of innate immunity. Among the different types of TLR, TLR2 plays a key role in recognition of specific microbial structures such as peptidoglycan (PGN), lipoteichoic acid (LTA), zymosan etc., and after attaching with them it stimulates myeloid differentiation primary response gene 88 (MyD88)-dependent signaling pathway in order induce various cytokines.
2.3.6.6. Impact of thiamethoxam on TLR2 expression:
Moreover, in a recent study made by Khalil et al. (2020) to evaluate immunotoxic impacts of the lambda cyhalothrin (LCH) insecticide on O. niloticus fish, fish was sampled following 30-days exposure to LCH (1/6 LC50: 0.48 μg/L). Results revealed a downregulation in expression of Interferon (IFN-γ) Immunoglobulin M heavy chain (IgM), CXC-chemokine, and Toll-like receptors (TLR-7) levels in the spleen.
In contrast to Zhao et al. (2020) argued that cypermethrin and sulfamethoxazole caused upregulation in transcriptional level of genes enter in Toll-like receptors (TLR) signaling pathway of grass carps intoxicated spleens when fish subjected to 42 days cypermethrin (CMN, 0.651 μg/L) or/and sulfamethoxazole (SMZ, 0.3 μg/L) in order to evaluate their effects on oxidative stress, immune response, DNA damage and apoptosis of fish spleen.
However, Tang et al. (2021) observed that diazinon caused significant downregulation in expression of TLR4, MyD88, NF-kB p100 and IL-8 genes while there was no significant change in TNF-α (P = 0.8239) under treatment of crucian carp with 300 μg/L of diazinon for 21 days to determine its effect on innate immunity genes.
Mohamed et al. (2022) conducted a study to evaluate the impact of Voliam flexi® 40% WG (thiamethoxam + chlorantraniliprole) on Clarias gariepinus. Beside a control group, fish were intoxicated by 3 sublethal concentrations of Voliam flexi® (43.5, 87.5, and 175 mg/L) for 15 days. Immunotoxic changes was induced by Voliam flexi® in C. gariepinus, including a decrease in several immunity indices (lysozyme and phagocytic activity, immunoglobulin levels, and nitro blue tetrazolium level). Additionally, it caused an elevation of primary cytokines levels (interleukin-1β and IL-6), in relation to the control group.
In addition, Yang et al. (2023) mentioned that after 24h of acute toxicity test with Thiamethoxam (300 µg/L), there was marked upregulation in the expression levels of Tolllike receptors genes (including TLR1 and TLR2) and LITAF in Chinese mitten crab (Eriocheir sinensis) when fish exposed to 0 µg/L, 150 µg/L and 300 µg/L of thiamethoxam for 96h. The experiment was performed to explore the impact of thiamethoxam on inflammatory signaling pathway-related genes.
2.3.7. Thiamethoxam residues and bioaccumulation:
2.3.7.1. Impact of thiamethoxam on human health:
Seltenrich (2017) indicated that altered neurological or developmental outcomes such as memory loss, congenital anencephaly, autism spectrum disease and tetralogy of Fallot, would arise due to prolonged exposure to neonicotinoids.
In addition, Mesnage et al. (2018) claimed that neonicotinoids could have adverse effects on could cause adverse reproduction, development, and physiology of humans, involving reduction of sperm output and function, decreased pregnancy rate, raised fetal mortalities, still-birth rate, and preterm birth rate, with reduced weights and lipid accumulation in the offspring.
Moreover, Thompson et al. (2020) mentioned that the little knowledge from crosssectional or ecological epidemiological studies has revealed that neonicotinoid exposure in human results in acute and chronic health impacts varying from acute signs of respiratory, cardiovascular, and neurological damage to oxidative genetic damage and birth abnormalities.
2.3.7.2. Thiamethoxam residues in fish:
According to Sweilum (2006) pesticide residues observe to increase in the flesh, liver and gills of Nile tilapia with increasing pesticide concentrations in fish ponds. Particularly, the pesticides higher bioaccumulation was observed in liver than in gill or flesh, as fish flesh revealed the lowest residues levels for these pesticides when fish subjected to sublethal doses of dimethoate (20, 10 and 5mg L_1) and malathion (2.0,1.0 and 0.5mg L_1) for 24 weeks.
In the same vein, Abd El-hameed et al. (2021) found an increase in imidacloprid (IMID) levels of residues in Nile tilapia flesh and liver tissues when exposed to a sub-lethal dose of IMID (0.0109 μg/L) for 14 days.
Unlike Iturburu et al., Guedegba et al. (2021) argued that, Nile tilapia exposed to sublethal concentrations of Acer 35 EC (a binary mixture of lambda-cyhalothrin and acetamiprid) at (0, 1 and 10% of LC50- 96 h value) then after 28 and 56 days of exposure muscle samples were collected. The results showed that regardless of the exposure duration, fish muscles intoxicated by higher Acer 35 EC concentration had increased residues concentrations of both lambda-cyhalothrin and acetamiprid.
Likewise, Yang et al. (2022) published a paper about the bio-uptake, tissue distribution and metabolism of neonicotinoids in zebrafish tissues, taking clothianidin (CLO) insecticide as an example for neonicotinoids. The findings revealed that the highest accumulation for CLO was found in intestine and liver, whereas the lowest level was observed in muscles.
Furthermore, Wang et al. (2022) suggested that, the concentrations of neonicotinoids in freshwater around the world were expected to range from 10.6 (6.88– 23.4) (thiacloprid) to 339 (211–786) ng/L (thiamethoxam) with estimated risk quotients ranged from 3.23 (dinotefuran) to 21.73 (thiacloprid).
Similarly, Yang et al. (2023) demonstrated that in adult zebrafish subjected to 3 concentrations of thiamethoxam (THM) (0.1, 10, and 1000 μg/L) for 45 days, in conclusion, residues of THM were detected in fish brain tissues in all intoxicated groups with the maximum brain residual concentration observed at 1000 μg/L treatment group which was significantly higher when compared with other groups (p < 0.05).
A recent investigation made by Zhang et al. (2023) about thiamethoxam (TMX) residual concentrations in red swamp crayfish tissues exposed to 10 ppt of thiamethoxam insecticide for 7days. The results supported the previous studies by showing a dramatic increase in Thiamethoxam content in the muscles and hepatopancreas of the exposed group (P < 0.05) when compared to the control one.
According to Wang et al. (2023), TMX is widely found in a variety of matrices in the environmental matrices likewise in food and human samples. Also TMX detection rate in global surface water was 81.3 %, with the values ranging from 0.002 to 4315 ng/L.
2.3.8. Mortalities induced by thiamethoxam exposure:
Ullah and Zorriehzahra (2014) mentioned that usually pesticides at acute doses leads to fish mortality whereas sub lethal concentration lead to various lethal effects. These effects may be behavioral changes of the intoxicated fish including abnormal feeding behavior, avoiding or attacking behavior and reproductive behavior, besides other types of changes such as histopathological changes in various organs, hematological changes, antioxidant defense system alterations (Peroxidase, Catalase, Glutathione reductase, Superoxide dismutase, Glutathione peroxidase, Glutathione-Stransferase etc.), nutrient profile abnormalities (Lipids, proteins, Carbohydrates and Moisture content), changes in hormonal or enzymatic profiles, and genotoxicity.
Moreover, Albinati et al. (2016) found a direct relationship between mortalities rates of Nile tilapia fingerlings and increased thiamethoxam insecticide concentration during an experimental trial, in which tilapia were exposed to 150, 300, 450, 600 and 750mg / L Actara.
Mukherjee et al. (2022) clarified that freshwater walking catfish death rate increased with an elevation in the exposure dose of thiamethoxam and treatment duration as they were subjected to different acute doses of Actara® (105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175 and 180 mg L−1).
3. MATERIAL AND METHODS
3.1. Ethical approval:
The experiment was approved by Institutional Animal Care and Use Committee (IACUC) Alexandria University (225).
3.2. Location of the experiment:
The present study was carried out in the laboratory of Fish diseases department, Animal Health Research Institute, Alexandria branch, Egypt during the period extended from 10 July to 10 August, 2023 to evaluate the effect of water pollution by Thiamethoxam insecticide on health condition of Nile tilapia (Oreochromis niloticus).
3.3. Experimental design:
The experiment was scheduled for three weeks to evaluate the toxic effects of Thiamethoxam insecticide on the health status of fish through determination of some biochemical parameters in fish serum, histopathological changes in liver and gills of fish beside molecular detection of growth and immunity gene expression and lastly determination of insecticide residue in fish flesh. The used insecticide was Actara 25 WG manufactured by Sygenta, Egypt and it was purchased from Egyptian Company for Seeds and Agricultural Chemicals. It composed of 250 g/kg thiamethoxam, 3-(2chlorothiazol-5ylmethyl)-5-methyl-(1,3,5) oxadiazinan-4-yldene-N-nitroamine and 750 g/kg inert ingredients.
A total of 200 O. niloticus with an average initial weight of 15 ± 5 g have been obtained from a commercial fish farm in Kafr Elsheikh province, Egypt. They were transported in safe oxygenated tanks. After that, they were placed upon arrival in 100 L glass aquaria provided with artificial aeration. Fish were kept for acclimatization for seven days in chlorine free water where they were given feed twice daily. Fish were given pelleted feed (Skretting Egypt, 30 % crude protein at a rate of 3% of fish body weight). A biweekly partial water exchange with the help of siphoning tube that remove wastes and feed residues from all the aquariums and keep them clean as much as possible was performed. After that, fish were randomly allotted to five replicated treatments. They were kept at a density of 10 fish / aquaria. Four different concentrations of the insecticide were tested with three replicates of fish for each treatment beside a control group where with no insecticide were used (Table, I). Tested concentrations of studied insecticide was selected according to lethal concentration 50 (LC50 for Thiamethoxam was 500 mg/l) where chronic treatments were 1/20 (5%) and 1/10 (10%) of LC 50 while subacute treatments were 2/10 (20%) and 5/10 (50%) of LC 50.
Table (I): Description of experimental fish groups to evaluate effects of thiamethoxam
Treatment (T) Fish groups Thiamethoxam
Dose Duration
T1 Control group No insecticide 21 days
T2 Low chronic dose 25 mg/l 21 days
T3 High chronic dose 50 mg/ l 21 days
T4 Low subacute dose 100 mg/ l 4 days
T5 High subacute dose 250 mg /l 4 days
3.4. Evaluation of water quality of aquaria:
For dissolved oxygen (DO), a portable oxygen meter (Microprocessor Oxygen Meter HI 9143, HANNA instruments) was utilized. The pH was calculated using a portable AD 11 Waterproof pH meter, and the water temperature was monitored using a TH310 Pocket-sized Thermometer with an automated calibration check to keep the water chemistry within permissible norms (Boyd and Tucker, 2012), which were as follows: pH (7.7 ± 0.1); temperature (22± 1).
As well salinity and oxygen saturation percentage were determined to assess the impact of Thiamethoxam on these water quality parameters and these parameters were measured at Water Pollution and Marine Environment Lab., Institute of Graduate Studies and Research.
3.5. Samples used:
• Serum samples for biochemical analysis.
• Liver and gills samples for histopathological examination.
• Extracted liver samples in RNA latter for RT-PCR analysis.
• Fish samples for residues evaluation.
3.6. Biweekly fish weighting:
It was performed to determine both final weights and weight gain of fish.
3.7. Serum biochemical analysis:
The following biochemical parameters were determined in different experimental groups including liver and kidney function tests beside some metabolic parameters.
Table (II): Determination of serum biochemical indices
Serum biochemical Assay method Reference
Total protein BioMed Total Protein kits Gornal et al.,
(1949)
Serum albumin BioMed Albumin kits Duomas et al.,
(1971)
Serum globulin Globulin = Total protein − Albumin Duomas et al.,
(1971)
Glucose GLUCOSE MR kits McMillin, (1990)
Alanine aminotransferase
(ALT) Alanine aminotransferase (ALT/GPT) - Ultimate Single Reagent E.C.2.6.1.2 kits Reitman and
Frankel, (1957)
Aspartate aminotransferase
(AST) Alanine aminotransferase (ALT/GPT) - Ultimate Single Reagent E.C.2.6.1.2 kits Reitman and
Frankel, (1957)
Urea Urea kits Fawcett and
Scott, (1960)
Creatinine Creatinine kits Bartels et al., (1972).
Triacylglycerol (TAG) Triacylglycerol kits Fossati and
Prencipe, (1982).
Cholesterol Cholesterol kits Allain et al.,
(1974).
HDL High density lipoprotein kits Yeates et al.,
(1979).
LDL Low density lipoprotein kits Hoffmann et al.,
(1982).
VLDL Very low density lipoprotein kits
3.8. Assay of serum total antioxidant capacity (TAC), superoxide dismutase (SOD) activity and Malondialdehyde (MDA):
The serum antioxidant activities were monitored using Sunostick Sba733 spectrophotometer multi-parameter analyzers. TAC was measured employing Total Antioxidant Capacity Colorimetric methods according to Koracevic et al., (2010). Superoxide dismutase (SOD) was assessed according to Nishikimi et al., (1972) (SD 25 21), while Malondialdehyde (MDA) was measured using Malondialdehyde (Colorimetric method) MD 25 29 kits according to Ohkawa et al. (1979).
3.9. Histopathological examination for gills and liver:
After the end of the experiment, fish were sacrificed and gill and liver tissues were excised from the five treatments (three fish per replicate from each treatment). Tissues were then fixed in 10% neutral formalin for 48 h. This was followed by dehydration in alcoholic grades, clearing in xylene and embedding in paraffin wax. 5 μM thick sections were cut in an automated microtome (RM-2155, Leica) followed by double staining using haematoxylin-eosin. The slides were mounted in distyrene plasticizer xylene (DPX) and visualized under a binocular research microscope attached to a digital camera (Model:
DIGI510, Dewinter biological microscope with 5.1 MP camera, 1/2.5″ Aptina CMOS sensor) (Mukherjee et al., 2022).
3.10. Real time PCR analysis:
It was performed at Biotechnology unit at Reference lab for veterinary quality control on poultry production, Animal health research institute, Dokki, Giza, Egypt.
Table (III): Oligonucleotide primers and probes used in SYBR Green real time PCR (Metabion, Germany)
Gene Primer sequence (5’-3’) References
EF-1α CCTTCAACGCTCAGGTCATC Gröner et al., (2015)
TGTGGGCAGTGTGGCAATC
TLR2 CCCACAATGGATTCACCAG Midhun et al., (2019)
AAAGATCAAGACTCAAGGCACTG
Ghrelin GCAGAAGACTTGGCGGACTACAT Zou et al., (2017)
ATAAACCAGAAAGAAGGGACAACC
CAT TCCTGAATGAGGAGGAGCGA Afifi et al., (2016)
ATCTTAGATGAGGCGGTGATG
3.10.1. Extraction of RNA According to RNeasy Mini Kit instructions:
• Thirty mg of organ sample was weighed and put in 2 ml screw capped tubes.
• 600 μl of Buffer RLT (with 10 μl ß-Mercaptoethanol/ ml Buffer RLT) was added into the tubes.
• For homogenization of samples, tubes were placed into the adaptor sets, which are fixed into the clamps of the TissueLyser.
• Disruption was performed in 2 minutes high-speed (30 Hz) shaking step.
• The lysate was centrifuged for 3 min at 14000 rpm.
• One volume of 70% ethanol was added to the cleared lysate, and mixed immediately by pipetting.
• Up to 700 μl of the sample transferred to an RNeasy spin column placed in a 2 ml collection tube. Centrifugation was done for 1 min. at 14000 rpm. The flow-through was discarded.
• Step 6 was repeated again for the excess volume.
• 700 μl of Buffer RW1 was added. Centrifugation was done for 1 min. at 10000 rpm. The flow-through was discarded.
• 500 μl of Buffer RPE was added. Centrifugation was done for 1 min. at 10000 rpm. The flow-through was discarded.
• Step 9 was repeated again, but Centrifugation was done for 2 min. at 10000 rpm.
• RNA was eluted by adding 50 μl RNase-free water. Centrifugation was done for 1 min. at 10000 rpm.
3.10.2. Preparation of PCR master Mix according to Quantitect SYBR green PCR kit:
Component Volume/reaction
2x QuantiTect SYBR Green PCR master Mix 12.5 μl
Reverse transcriptase 0.25 μl
Forward primer (20 pmol) 0.5 μl
Reverse primer (20 pmol) 0.5 μl
RNase Free Water 8.25 μl
Template RNA 3 μl
Total 25 μl
3.10.3. Cycling conditions for SYBR green real time PCR according to Quantitect SYBR green PCR kit:
Targe
t gene Reverse transcripti on Primary denaturati on Amplification (40 cycles) Dissociation curve (1 cycle)
Secondary denaturati on Anneali ng
(Optics on) Extensi on Secondary denaturati on Anneali ng Final denaturati on
EF-
1α 50˚C
30 min. 94˚C
15 min. 94˚C 15 sec. 62˚C
30 sec. 72˚C 30 sec. 94˚C 1 min. 62˚C
1 min. 94˚C 1 min.
TLR2 60˚C
30 sec. 60˚C 1 min.
Ghreli n 59˚C
30 sec. 59˚C
1 min.
CAT 60˚C
30 sec. 60˚C
1 min.
3.10.4. Analysis of the SYBR green rt-PCR results:
Amplification curves and Ct values were determined by the strata gene MX3005P software. To estimate the variation of gene expression on the RNA of the different samples, the CT of each sample was compared with that of the control group according to the ”ΔΔCt” method stated by Yuan et al. (2006) using the following ratio: (2- ct). Whereas ΔΔCt = ΔCtreference - ΔCttarget
ΔCt target = Ct control – Ct treatment and ΔCt reference = Ct control- Ct treatment.
3.11. HPLC analysis of Thiamethoxam residues in fish flesh:
The tests were performed at Agricultural Research Center, Central Laboratory of Residues Analysis of Pesticides and Heavy Metals in Food, Dokki, Giza, Egypt, through Quick and easy method (QuEChERS) for determination of pesticide residues in food using LC-MSMS, GC-MSMS. (European Standard Method EN 15662:2018 with a method named; QuEChERS Method Fatty).
3.12. Determination of Mortality rate:
Mortalities were determined throughout the experiment duration to determine the impact of Thiamethoxam on fish survival.
3.13. Statistical analysis
All the gathered data were analyzed for normality using the Shapiro– Wilk test. Then, one-way ANOVA was assessed to conduct a statistical evaluation of the results from the differently treated fish gathering under SAS (2009). Duncan’s multiple range tests were applied as well to detect any anticipated significant differences between treated fish groups at a significant level of 95%.
4. Results
1. Water quality parameters:
Table (1): Mean values of some parameters regarding water quality after using different levels of thiamethoxam insecticide
PH DO (mg/l) DO % Salinity (PSU)
Control 7.70 ± 0a 7.80 ± 0a 91.14 ± 0a 0.134 ± 0b
Low chronic dose 7.08 ± 0b 7.80 ± 0a 82.37 ± 0b 0.134 ± 0b
High chronic dose 7.07 ± 0c 7.20 ± 0b 76.03 ± 0c 0.124 ± 0d
Low subacute dose 6.87 ± 0d 6.90 ± 0c 72.86 ± 0d 0.128 ± 0c
High subacute dose 6.83 ± 0e 6.70 ± 0d 70.75 ± 0e 0.144 ± 0a
Means within the same column with different superscripts are significantly different (p<0.05).
Data exhibited in Table (1) and Fig. (1) illustrates some water parameters after using different levels of thiamethoxam insecticide. Statistically, in pH, dissolved oxygen levels (DO), oxygen saturation percentage (DO%) and salinity, there were significant differences between different thiamethoxam treated groups and the control group, where the lowest significance observed regarding the pH, DO and DO% was at the high subacute dose while in salinity it was at the high chronic dose with the highest significance at the high subacute dose. Furthermore, PH, DO and DO% values decreased with increasing thiamethoxam concentration in water. Consequently, PH value decreased after 3weeks treatment to be nearly 7.08 at the low chronic dose (25mg/l) and 7.07 at the high chronic dose (50mg/l) when related to the control group that was about 7.7. Similarly, in the 96h low subacute dose (100mg/l) PH reached 6.87 as well the high subacute dose (250mg/l) markedly lowered the PH to be 6.83. Additionally, DO in the unexposed water was 7.8mg/l with the same value observed in the 3weeks low chronic dose (25mg/l) while the high chronic dose (50mg/l) showed lower DO (7.2mg/l). On the other hand, in 96h low subacute dose (100mg/l) decreased the DO to become 6.9mg/l while it was 6.7mg/l at the high subacute dose (250mg/l). Moreover, oxygen saturation at the untreated water was
91.14% while after 3weeks treatment by low chronic dose (25mg/l) of thiamethoxam it was 82.37% and decreased to 76.03% at the high chronic dose (50mg/l). In the same vein, DO% lowered at 96h low subacute dose (100mg/l) to be 72.86% and 70.75% at the high subacute dose (250mg/l). Lastly, salinity detected in both unexposed water and 3weeks low chronic dose (25mg/l) was 0.134PSU while in the high chronic dose (50mg/l) was 0.124PSU. In addition, in 96h low subacute dose (100mg/l), it was 0.128PSU but it increased markedly in the high subacute dose (250mg/l) to become 0.144PSU.
Fig. (1): Mean values of some parameters regarding water quality after using different levels of thiamethoxam insecticide
2. Growth rate and weight gain:
Table (2): Effect of thiamethoxam insecticide on growth rate of Nile tilapia
Productive parameters Initial wt Final wt ± SD Wt gain ± SD
Treatment Means ± SD Means ± SD Means ± SD
Control 15.17 ± 0.026a 25.35± 0.15a 10.22 ± 0.081a
Low chronic dose 15.13 ± 0.043a 21.21 ± 0.13c 6.42 ± 0.47b
High chronic dose 15.14 ± 0.13a 20.57 ± 0.17d 5.43 ± 0.19c
Low subacute dose 15.14 ± 0.028a 24.77 ± 0.44b 9.69 ± 0.48a
High subacute dose 15.20 ± 0.035a 24.34 ± 0.49b 9.80 ± 0.097a
Means within the same column with different superscripts are significantly different (p<0.05)
As presented in Table (2) and Fig. (2) showed the effect of thiamethoxam
insecticide on growth rate of Nile tilapia. Statistically, there was a significant difference in final weight and weight gain of all treatments when compared with the control group. In addition, the lowest significance in the final weight and weight gain was observed at the high chronic dose while there was no significant change between both subacute doses. It was recorded that the final weight decreased with increasing the chronic dose of thiamethoxam when compared with control group, as the low chronic dose (25 mg/l) was nearly 21.2 g with a weight gain about 6.4 g while the high chronic dose (50 mg/l) showed more decrease in final weight about 20.5 g with weight gain nearly 5.4 g after 3 weeks. In contrast, there was no obvious change in final weight and weight gain of both low (100 mg/l) and high (250 mg/l) subacute doses after 96h as the final weights were 24.3 and 24.7, respectively with a weight gain around 9.6 g since the start of the experiment.
Fig. (2): Effect of thiamethoxam insecticide on growth rate of Nile tilapia
Results
2. Biochemical indices:
Table (3): Biochemical parameter among different levels of thiamethoxam in Nile tilapia
34
Data in Table (3) and Fig. (3) revealed the effect of thiamethoxam on serum proteins, Statistically, there was no significant change between different treatments and the control one. It was estimated that serum protein increased with increasing thiamethoxam concentration when compared to the control one (4.39 g/dl). Consequently, after 3 weeks, low chronic dose (25 mg/l) showed no observed increase nearly 4.3 g/dl while the high chronic dose (50 mg/l) revealed rise in protein level about 4.6 g/dl. Furthermore, results of subacute doses after 4d showed that thiamethoxam raised the protein level compared to control group as the low subacute dose (100 mg/l) was nearly 4.43 g/dl and the high subacute dose (250 mg/l) showed 5 g/dl protein concentration and that was the highest value detected.
Fig. (3): Effect of thiamethoxam insecticide on serum protein in Nile tilapia Similarly, data illustrated in Table (3) and Fig. (4) demonstrated the effect of thiamethoxam insecticide on serum albumin (SA). Statistically, thiamethoxam had no significant change on SA at different treatments as well there was no difference between them and the control group. Additionally, results showed a raise in albumin concentrations as the concentrations of thiamethoxam increased, 3weeks chronic doses showed an increase of albumin as compared to control which was about 3g/dl with nearly 3.43g/dl albumin at low chronic dose (25mg/l) while high chronic dose (50mg/l) treatment showed higher SA about 3.72g/dl. Besides, SA in both 4d subacute doses experienced an increase in relation to the control group in which at low subacute dose (100mg/l) SA was about 3.13g/dl whereas at the high subacute dose (250mg/l), SA raised to 3.47g/dl.
Fig. (4): Effect of thiamethoxam insecticide on albumin level in Nile tilapia
The data exhibited in Table (3) and Fig. (5) revealed the effect of thiamethoxam on serum globulin in Nile tilapia. Statistically, thiamethoxam did not cause a significant difference between the control group and both chronic and subacute treatments. While there was a significant difference in SG level between both chronic and subacute doses with the lowest significance observed in the low subacute treatment. Moreover, there was an observed elevation in globulin level with increasing thiamethoxam doses, briefly, after 3 weeks of using chronic doses, the level of globulin in the low chronic dose (25mg/l) was about 1.81g/dl when compared to the control group which was nearly 1.71g/dl, furthermore, the high chronic dose (50mg/l) increased the level of globulin to approximately 1.95g/dl. In contrary to the chronic doses, 4d subacute doses resulted in decreasing globulin level in comparison with the un exposed group. As globulin levels at both low subacute dose (100mg/l) and high subacute dose (250mg/l) were about 1.30g/dl and 1.58g/dl, respectively.
Fig. (5): Effect of thiamethoxam insecticide on serum globulin in Nile tilapia
Regarding Table (3) and Fig. (6), data showed the effect of thiamethoxam insecticide on creatinine concentration in Nile tilapia. Statistically, there was a significant difference between high chronic dose and high subacute dose as compared to the control group, in addition the highest significant regarding creatinine level was observed at the high subacute dose while the lowest significance was at the low subacute one. Moreover, results reported that creatinine levels increased as thiamethoxam concentrations increased, compared to the un treated group (0.88mg/dl), low chronic dose (25mg/l) showed a slight increase in creatinine level about 0.89mg/dl while the increase in high chronic dose (50mg/l) reached nearly 0.96mg/dl after 3weeks treatment. Whereas in 96h treatment, creatinine level decreased slightly in low subacute dose (100mg/l) (0.85mg/dl), in contrast to the high subacute dose (100mg/l) which showed the highest creatinine level about 1mg/dl.
Fig. (6): Effect of thiamethoxam insecticide on creatinine level in Nile tilapia As shown in Table (3) and Fig. (7) showed the effect of thiamethoxam insecticide on urea level in Nile tilapia. Statistically, there were no significant differences between the control group and subacute doses while there was a high significance observed at the high chronic dose compared to other treatments. Furthermore, there was a slight rise in urea level after 3weeks low chronic dose treatment (25mg/l) about 21.84mg/dl besides the highest urea concentration observed (24.4mg/dl) was at the high chronic dose (50mg/l). In contrast, both subacute doses resulted in a slight decrease of urea levels, as urea levels at low subacute dose (100mg/l) was about 18.75mg/dl while at high subacute dose (250mg/l) was 19.3mg/dl.
Fig. (7): Effect of thiamethoxam insecticide on urea level in Nile tilapia
The illustrated data in Table (3) and Fig. (8) highlighted the effect of thiamethoxam insecticide on glucose level in Nile tilapia. Statistically, no significant differences were detected between all the treated groups and the control group as well. As a consequence of 3weeks thiamethoxam treatment, glucose level was observed to be increased with increasing the intoxication dose. As the low chronic dose (25mg/l) resulted in glucose level about 75.5mg/dl whereas the high chronic dose (50mg/dl) resulted in 89.01mg/dl when compared to the control group that was nearly 70.8mgdl. On the other hand, after 96h treatment, glucose level showed no detected change at the low subacute dose (100mg/l) as it was 69.54mg/dl, in contrary to this, the high subacute dose (250mg/l) resulted in the highest level of all treatments which was about 94.03mg/dl.
Fig. (8): Effect of thiamethoxam insecticide on glucose level of Nile tilapia
The data presented in Table (3) and Fig. (9) represented the effect of thiamethoxam insecticide on alanine transaminase (ALT) level in Nile tilapia. Statistically, there were no significant differences in ALT level between all treatment doses and the control group except for the high chronic dose, besides it showed the highest significance of all treatments. However, results of 3weeks treatment with Thiamethoxam revealed an increase in ALT level by increasing the concentration of thiamethoxam. On brief, low chronic dose (25mg/l) resulted in ALT level about 10.8 U/L whereas the highest value (13.11 U/L) of all treatments was at the high chronic dose (50mg/l) while ALT level at the control group was 9.7U/L. However, the both 96h subacute doses caused a slight increase in ALT as compared to control group with no detected change between them as ALT level at the low subacute dose (100mg/l) was 10.8U/L while at high subacute dose was 10.34U/L.
Fig. (9): Effect of thiamethoxam insecticide on ALT level in Nile tilapia
Data in Table (3) and Fig. (10) illustrated the effect of thiamethoxam insecticide on aspartate transaminase (AST) level in Nile tilapia. Statistically, there were no significant differences between the un treated group and other treated ones, however, there were a significant differences observed between both low chronic dose and high subacute dose than other treated groups with the lowest detected significance at the low chronic dose. The represented findings suggested the compared to the AST level at the control group (48.6U/L), its level exhibited an observable increase with elevating thiamethoxam dose except for the low chronic dose. Hence, in 3weeks treatment, AST level at the low chronic dose (25mg/l) was nearly 41.43U/L whereas the high chronic dose (50 mg/l) led to an increase of this value to reach about 56.6U/L. Additionally, the 96h thiamethoxam treatment caused AST level to become almost 55.3 U/L at the low subacute dose (100 mg/l) and 66.62U/L, which was the highest level of all treatments, at the high subacute one (250 mg/l).
Fig. (10): Effect of thiamethoxam insecticide on AST level in Nile tilapia
Data in Table (3) and Fig. (11) revealed the effect of insecticide on cholesterol level in Nile tilapia. Statistically, no significant differences observed between treatment groups also between them and the control group. On the other hand, cholesterol level expressed an increase in its level only in the 3weeks high chronic dose (50mg/l) which was about 121.31mg/dl and 123.81mg/dl at the 96h low subacute dose (100mg/l) while the control group showed cholesterol level nearly 118.1mg/dl. In contrast, thiamethoxam low chronic dose (25mg/l) decreased cholesterol level at nearly 116.9mg/dl as well the high subacute dose (250mg/l) has led to 115.44mg/dl which was the lowest value for cholesterol of all treatments.
cholestrol
126
124
122
120
118
116
114
112
110
Control Low chronic High chronic dose dose Low subacute dose High subacute dose
Fig. (11): Effect of thiamethoxam insecticide on cholesterol level in Nile tilapia
Data in Table (3) and Fig. (12) explained the effect of thiamethoxam on triacylglycerol (TAG) level in Nile tilapia. Statistically, there were no significant differences between various treatment groups and the control one with exception to the low subacute dose that had the lowest significant change of all treatments. Furthermore, within 3weeks thiamethoxam decreased TAG level at the low chronic dose (25mg/l) to nearly 124.01mg/dl as compared to the control group that was 135.65mg/dl, in contrast to this thiamethoxam high chronic dose (50mg/l) resulted in a slight increase in TAG level (138.21mg/dl). Moreover, 96h thiamethoxam low subacute dose led to a marked decrease in TAG nearly 124.26mg/dl while the high subacute dose after 96h treatment resulted almost in no change in TAG level (135.58mg/dl) as compared with the control group.
Fig. (12): Effect of thiamethoxam insecticide on TAG level on Nile tilapia Data in Table (3) and Fig. (13) clarified the effect of insecticide on very low density lipoproteins (VLDL) level in Nile tilapia. Statistically, there were significant differences between various treatment groups and the control group except for both low chronic dose and high chronic dose that showed no significant changes with the lowest significance observed at the high chronic dose. However, while VLDL level at the untreated group was 26.13mg/dl, both 3weeks thiamethoxam low (25mg/l) and high (50mg/l) chronic doses have led to an increase in VLDL level to reach nearly 26.6mg/dl and 29.8mg/dl, respectively. Conversely, the 96h low subacute dose (100mg/l) decreased VLDL level (22.85mg/dl) whereas it showed an increase at the high subacute dose (250mg/l) to almost 27.10mg/dl.
Fig. (13): Effect of thiamethoxam insecticide on VLDL levels in Nile tilapia The represented data in Table (3) and Fig. (14) explained the effect of thiamethoxam on high density lipoproteins (HDL) level in Nile tilapia. Statistically, there were no significant differences in HDL levels between treatment groups and control one except for the high subacute dose which had the highest significance and the high chronic dose which represented the lowest significance. Furthermore, thiamethoxam was found to decrease the HDL level by increasing the treatment dose as compared to the control group that was 34 mg/dl. Consequently, HDL level at the low chronic dose (25 mg/l) after 3 weeks was 24.5 mg/dl while it was 20.24 mg/dl at the high chronic dose (50mg/l). Additionally, in 96h of using thiamethoxam, low subacute dose (100mg/l) decreased HDL to reach nearly 32.3 mg/dl, in contrast, the high subacute dose (250mg/l) markedly increased HDL level to become about 43.3mg/dl.
Fig. (14): Effect of thiamethoxam insecticide on HDL level in Nile tilapia Data in Table (3) and Fig. (15), illustrates the effect of on low density lipoproteins (LDL) levels in Nile tilapia. Statistically, no significant differences observed in LDL levels between thiamethoxam treated groups and control group. Findings demonstrated revealed that LDL level increased (62.13mg/dl) after 3weeks low chronic doses (25mg/l) when compared to the control group (54.63mg/dl), whereas the high chronic dose (50mg/l) resulted in lowering LDL levels (52.62mg/dl). Similarly, LDL level showed a marked increase in its value to reach almost 68.66mg/dl after 96h treatment with low subacute dose (100mg/l), in spite of this the high subacute dose (250mg/l) decreased LDL levels to be nearly 45mg/dl.
Fig. (15): Effect of thiamethoxam insecticide on LDL level in Nile tilapia
4. Oxidative stress indices:
Table (4): Oxidative stress parameters among different levels of thiamethoxam in Nile tilapia
Treatment groups SOD (U/ml)
Means ±SD MDA (mM/ml)
Means ±SD TAC (mM/ml)
Means ±SD
Control 3.27 ± 0.23a 1.05 ± 0.24b 21.83 ± 0.63a
Low chronic dose 3.07 ± 0.13a 1.41 ± 0.15a 18.90 ± 2.51ab
High chronic dose 2.94 ± 0.23a 1.58 ± 0.05a 17.70 ± 3.90ab
Low subacute dose 3.17 ± 0.46a 1.64 ± 0.04a 19.70 ± 0.43ab
High subacute dose 3.03 ± 0.52a 1.57 ± 0.11a 16.20 ± 2.81b
Means within the same column with different superscripts are significantly different (p<0.05).
Data exhibited in Table (4) and Fig. (16) clarified the effect of thiamethoxam insecticide on serum oxidative stress parameters in Nile tilapia. Statistically, there were no significant differences in super oxide dismutase (SOD) levels between thiamethoxam treated groups and the control group. Moreover, for malondialdehyde (MDA), no significant differences observed between the treated groups but there was significant difference between them and the control group. Furthermore, there were no significant differences in total antioxidant capacity (TAC) levels between thiamethoxam treated group and control group while the lowest significance observed was at the high subacute dose. However, thiamethoxam treatment resulted in decreasing the SOD levels in relation to the control group which was 3.27U/ml. Consequently, after 3weeks treatment with thiamethoxam, low (25mg/l) and high (50mg/l) chronic doses resulted in SOD levels about 3.07U/ml and 2.94U/ml, respectively. Whereas the 96h low subacute dose (100mg/l) has led to SOD level nearly 3.17U/ml besides high subacute dose (250mg/l) resulted in 3.03U/ml. In contrast, THX treatment caused an elevation in MDA levels when compared to the control group (1.05mM/ml). Hence, in 3weeks experimental trial, MDA level increased slightly (1.41mM/ml) at the low chronic dose (25mg/l) and raised to about 1.58mM/ml at the high chronic dose (50mg/l). In addition, the 96h low subacute dose
(100mg/l) showed increased MDA levels about 1.64mM/ml while the high subacute dose
(250mg/l) lead to 1.57mM/ml which was in fact lower than the low subacute one. Obviously, TAC levels decreased as THX treatment concentrations increased. As a consequence, 3weeks low chronic dose (25mg/l) resulted in TAC level about 18.9mM/ml whereas it reached 17.7mM/ml at the high chronic dose (50mg/l) when compared to the control group (21.83mM/ml). On the other hand, TAC in 96h low subacute (100mg/l) treatment was 19.7mM/ml while in high subacute one (250mg/l) was 16.2mM/ml and that was the lowest value recorded.
Fig. (16): Effect of thiamethoxam insecticide on oxidative stress parameters in Nile tilapia
5. Histopathological alterations of gills and liver of Nile Tilapia:
Exposure of Nile Tilapia to thiamethoxam toxicity has led to damaging of many organs including liver and gills which resulted in biochemical and genotoxic changes. Our results have illustrated typical pathological changes in both gills and liver tissues with no observed damage in the tissues of the non-exposed group of fish.
5.1. Gills pathological changes:
Photo (1): Gill of Nile Tilapia fish of the Control group showing normal primary and secondary gill lamellae. H&E. (X 100).
Photo (2): Gill of Nile Tilapia fish of T2 group (Thiamethoxam 25 mg/l /21 days) showing lamellar lifting (arrows) and congestion of branchial blood vessel (stars).
Photo (3): Gill of Nile Tilapia fish of T2 group (Thiamethoxam 25 mg/l /21 days) showing filamentous clubbing (arrow)
Photo (4): Gill arch of Nile Tilapia fish of T2 group (Thiamethoxam 25 mg/l /21 days)
showing eosinophilic granular cells (EGCs) infiltration (arrows) and congestion of blood vessel (stars).
Photo (5): Gill of Nile Tilapia fish of T3 group (Thiamethoxam 50 mg/l /21 days) showing lamellar telangiectasis (arrows)
Photo (6): Gill of Nile Tilapia fish of T3 group (Thiamethoxam 50 mg/l /21 days) showing unilateral fusion of secondary lamellae (short arrows)
Photo (7): Gill arch of Nile Tilapia fish of T3 group (Thiamethoxam 50 mg/l /21 days) showing hemorrhage (asterisks)
Photo (8): Gill of Nile Tilapia fish of T4 group (Thiamethoxam 100 mg/l /4 days) showing curved secondary lamellae (arrows)
Photo (9): Gill of Nile Tilapia fish of T4 group (Thiamethoxam 100 mg/l /4 days) showing
lamellar lifting (arrows)
Photo (10): Gill arch of Nile Tilapia fish of T4 group (Thiamethoxam 100 mg/l /4 days) showing eosinophilic granular cells (arrows) and congestion of blood vessel (stars)
Photo (11): Gill of Nile Tilapia fish of T5 group (Thiamethoxam 250 mg/l /4 days) showing unilateral fusion of secondary lamellae (short arrows).
Photo (12): Gill of Nile Tilapia fish of T5 group (Thiamethoxam 250 mg/l /4 days) showing lamellar lifting due to edematous separation of lamellar epithelium from capillary beds (arrows)
Photo (13): Gill arch of Nile Tilapia fish of T5 group (Thiamethoxam 250 mg/l /4 days) showing eosinophilic granular cells (arrows) and congestion of blood vessel (stars)
5.2. Liver pathological changes:
Photo (14): Hepatopancreas of Nile Tilapia fish of control group showing normal
hepatocytes. H&E. (X 400)
(15): Hepatopancreas of Nile Tilapia fish of T2 group (Thiamethoxam 25 mg/l showing congestion of central veins (star)
Photo (16): Hepatopancreas of Nile Tilapia fish of T2 group (Thiamethoxam 25 mg/l /21 days) showing diffuse hydropic degeneration of hepatocytes (arrows)
(17): Hepatopancreas of Nile Tilapia fish of T2 group (Thiamethoxam 25 mg/l showing activation in melanomacrophage centers (MMCs) (arrow)
Photo (18): Hepatopancreas of Nile Tilapia fish of T3 group (Thiamethoxam 50 mg/l /21 days) showing congestion of central veins (star)
(19): Hepatopancreas of Nile Tilapia fish of T3 group (Thiamethoxam 50 mg/l showing sharp edge outline vacuoles of hepatocytes (arrows)
Photo (20): Hepatopancreas of Nile Tilapia fish of T3 group (Thiamethoxam 50 mg/l /21 days) showing activation in MMCs (arrow)
Photo (21): Hepatopancreas of Nile Tilapia fish of T4 group (Thiamethoxam 100 mg/l /4 days) showing congestion of central veins (star) and eosinophilic granular cells (arrow)
Photo (22): Hepatopancreas of Nile Tilapia fish of T4 group (Thiamethoxam 100 mg/l /4 days) showing destruction and necrosis of pancreatic acini (arrow)
Photo (23): Hepatopancreas of Nile Tilapia fish of T5 group (Thiamethoxam 250 mg/l /4 days) showing activation in MMCs (arrow) and congestion of blood vessel (star)
Photo (24): Hepatopancreas of Nile Tilapia fish of T5 group (Thiamethoxam 250 mg/l /4 days) showing sharp edge outline vacuoles of hepatocytes (arrows)
6. Gene expression by RT-PCR:
Table (5): Impact of thiamethoxam insecticide on growth related, immunity and stress genes expression in liver of Nile tilapia
Gene expression GHERLIN TLR2 CAT
Treatment groups
Control 1.00 ± 0.053a 1.00 ± 0.021e 1.00 ± 0.018a Low chronic dose 0.87 ± 0.043b 3.27 ± 0.45d 0.79 ± 0.06b
High chronic dose 0.74 ± 0.044c 5.89 ± 0.179c 0.61 ± 0.047c Low subacute dose 0.39 ± 0.074d 10.44 ± 0.664b 0.27 ± 0.048d
High subacute dose 0.24 ± 0.060e 15.97 ± 0.671a 0.069 ± 0.022e
Means within the same column with different superscripts are significantly different (p<0.05)
Data illustrated in Table (5) and Fig. (18) identified the impact of thiamethoxam insecticide on growth related (ghrelin), immunity (TLR2) and stress (CAT) genes expression in liver of Nile tilapia. Statistically, there were significant differences detected in the expression of the three genes between all thiamethoxam treated groups and the control one. In addition, the lowest significance regarding ghrelin and catalase (CAT) expression was observed at the high subacute dose, while the lowest one regarding toll like receptors 2 (TLR2) genes was at the low chronic dose. Moreover, there was a significant upregulation in TLR2 gene expression while that of both ghrelin and CAT was significantly down regulated. The demonstrated findings revealed that fold change mean value for growth related genes (ghrelin) decreased by increasing dose of thiamethoxam as the 3weeks low chronic dose (25mg/l) decreased its mean value to be nearly 0.87 while at the high chronic dose (50mg/l) was 0.74. On the other hand, in 96h treatment with higher doses of THX, ghrelin gene expression mean value dramatically decreased to be 0.39 at the low subacute dose (100mg/l) and 0.24 at the high subacute one (250mg/l). In contrast, results for fold change mean value of immunity genes (TLR2) showed a marked elevation with increasing thiamethoxam dose. Consequently, after 3weeks of thiamethoxam use, it was nearly 3.27 at the low chronic dose (25mg/l) and 5.89 at the high chronic dose (50mg/l). In spite of this, it was almost doubled (10.44) in the 96h low subacute dose (100mg/l) and reached 15.97 in the high subacute dose (250mg/l). Lastly, the genetic expression of oxidative stress gene (CAT) showed a dramatic decrease with elevating thiamethoxam concentrations. So, the fold change mean value for CAT was about 0.79 at the low chronic dose (25mg/l) where as it was 0.61 (50mg/l) at the high chronic dose after 3weeks experimental period. Moreover, these values continued to decrease to become almost 0.27 at the low subacute dose (100mg/l) and 0.069 in the high subacute (250mg/l) one in 96h experimental trial.
6 ∆CT and ∆∆CT of ghrelin gene
∆CT GHRELIN ∆∆CT GHRELIN Fold change
1 1.55 -0.02333333 1.016304932
1 1.51 -0.06333333 1.044877153
1 1.66 0.08666667 0.941696017
2 1.72 0.14666667 0.903335201
2 1.86 0.28666667 0.819793998
2 1.75 0.17666667 0.884744831
3 2.04 0.46666667 0.723634619
3 1.9 0.32666667 0.797376688
3 2.05 0.47666667 0.718636109
4 3.24 1.66666667 0.314980262
4 2.81 1.23666667 0.424351986
4 2.7 1.12666667 0.457972645
5 3.37 1.79666667 0.28783887
5 3.44 1.86666667 0.274206245
5 4.07 2.49666667 0.177185608
AV CONT 1.5733333
7 ∆CT and ∆∆CT of TLR2 gene
Column1 ∆CT TLR2 ∆∆CT TLR2 Fold change
1 1.14 0 1
1 1.11 -0.03 1.021012126
1 1.17 0.03 0.979420298
2 -0.32 -1.46 2.751083636
2 -0.71 -1.85 3.60500185
2 -0.65 -1.79 3.458148925
3 -1.39 -2.53 5.775716782
3 -1.4 -2.54 5.815890069
3 -1.47 -2.61 6.105036836
4 -2.32 -3.46 11.00433455
4 -2.14 -3.28 9.713559075
4 -2.27 -3.41 10.62948651
5 -2.91 -4.05 16.56423878
5 -2.79 -3.93 15.24220797
5 -2.87 -4.01 16.1112888
AV CONT 1.14
8 ∆CT and ∆∆CT of CAT gene
Column1 ∆CT CAT ∆∆CT CAT Fold change
1 2.6 -0.01 1.00695555
1 2.59 -0.02 1.01395948
1 2.64 0.03 0.979420298
2 2.91 0.3 0.812252396
2 3.07 0.46 0.726986259
2 2.86 0.25 0.840896415
3 3.27 0.66 0.632878297
3 3.46 0.85 0.554784736
3 3.25 0.64 0.641712949
4 4.44 1.83 0.281264621
4 4.79 2.18 0.220675749
4 4.27 1.66 0.316439148
5 6.98 4.37 0.048361406
5 6.48 3.87 0.068393356
5 6.04 3.43 0.092782723
AV CONT 2.61
Fig. (17): Impact of thiamethoxam insecticide on growth related, immunity and stress genes expression in liver of Nile tilapia
Fig. (18): Plot amplification for ghrelin gene
Fig. (19): Plot amplification for TLR2 gene
Fig. (20): Plot amplification for CAT gene
7. Thiamethoxam residues concentrations in fish flesh:
Table (9): Thiamethoxam residue in Nile tilapia muscles reared under different levels
Treatment groups Thiamethoxam residue mg/kg
Control 0.090 ± 0.001d
Low chronic dose 3.233 ± 0.305c
High chronic dose 3.366 ± 0.208bc
Low subacute dose 3.833 ± 0.351b
High subacute dose 19.766 ± 0.450a
Means within the same column with different superscripts are significantly different (p<0.05)
Data represented in Table (9) and Fig. (21) showed thiamethoxam residues in Nile tilapia muscles reared under different levels. Statistically, there were significant differences in thiamethoxam residues between various treatment groups and control group with highest significance detected at the high subacute dose. Moreover, thiamethoxam residues were obviously detected at the control group (0.090 mg/kg), with its value increased with increasing thiamethoxam treatment dose. As they were nearly 3.233 mg/kg after 3 weeks treatment with low chronic dose (25 mg/l) and it increased slightly (3.366 mg/kg) at the high chronic dose (50 mg/l). In addition, a slight rise observed (3.833mg/kg) in the residues after 96h low subacute dose (100 mg/l), whereas the residues level markedly increased at the high subacute dose (250 mg/l) to reach nearly 19.77 mg/kg.
Fig. (21): Thiamethoxam residues in Nile tilapia muscles reared under different levels
8. Thiamethoxam effect on mortalities:
Table (10): Impact of thiamethoxam insecticide on survival of Nile tilapia
Treatment groups Mortality
Control 0 ± 0b
Low chronic dose 0.66 ± 1.15ab
High chronic dose 1.00 ± 1.00ab
Low subacute dose 1.33 ± 0.57ab
High subacute dose 2.00 ± 0a
Means within the same column with different superscripts are significantly different (p<0.05)
Data displayed in Table (10) and Fig. (22) clarified the impact of thiamethoxam insecticide on survival of Nile tilapia. Statistically, there were no significant differences in mortalities between various treatment groups and the control group with exception to high subacute dose that showed the highest significance of all groups. In fact, mortalities were increased with increasing doe thiamethoxam dose, as no mortalities observed in the control group while during the 3weeks treatment, some individual mortalities were observed firstly at the low chronic dose (25 mg/l) and recorded to be nearly 0.66 as a mean value for mortalities where as in the high chronic dose (50 mg/l) it reached 1. On the other hand, during the use of 96h subacute treatments, mean values of mortalities elevated to be 1.33 in low subacute (100 mg/l), whereas it was 2 in high subacute dose (250 mg/l) which was the highest recorded value of all treatments.
Fig. (22): Impact of thiamethoxam insecticide on survival of Nile tilapia fish
5. Discussion
The persistent chemicals of pesticides produced from agricultural practices, urban use, and pesticide producing plants are the cause of pesticide contamination in water. The main users of pesticides are farmers, who heavily apply pesticides to protect and enhance their agricultural production. Depending on the pesticide’s specific qualities, Chemical components from the pesticide that was applied to the preserved material could be released into the environment, contributing to pesticide contamination in surface waterways. Compared to other pesticides like fungicides and herbicides, the insecticide is more frequently found in urban areas (Abd El Megid et al., 2020).
1. Water quality parameters:
Water quality parameters are important in fish survival and growth and any pollutant affect them may adversely harm aquatic organisms indirectly. Data exhibited in Table (1) and Fig. (1) illustrates some water parameters after using different levels of thiamethoxam insecticide. Statistically, in pH, dissolved oxygen levels (DO), oxygen saturation percentage (DO%) and salinity, there were significant differences between different thiamethoxam treated groups and the control group, where the lowest significance observed regarding the pH, DO and DO% was at the high subacute dose while in salinity it was at the high chronic dose with the highest significance at the high subacute dose. Furthermore, PH, DO and DO% values decreased with increasing thiamethoxam concentration in water. However, thiamethoxam treatment increased the salinity of water. The decreased DO% and DO may be attributed to the increased uptake of DO as a result of abnormal metabolic activity caused by stress response induced by thiamethoxam toxicity.
Our results showed an agreement with Perschbacher and Ludwig (2004) who concluded that Diuron pesticide significantly decreased water quality parameters related to the dose, oxygen levels were lowered dangerously after ten days in the high drift and direct treatments, and almost reached the control levels after nearly 3 weeks. Moreover, in the high drift and direct treatments, pH value was lowered concomitant with the chlorophyll a decrease. Also with HASAN et al. (2021) who found that dissolved oxygen markedly lowered with rising thiamethoxam concentration and duration in water whereas no detected variations were observed for pH and temperature, when applying thiamethoxam at concentrations (9.37, 18.75, 37.5, 75 and 150 mg/L) for 60 days.
Besides Huang et al. (2023) showed that Diflubenzuron had a negative impact on pH and DO levels when applied at 0, 0.74, 2.222, 6.667, 20, and 60 μg /l . However, they supposed that the decrease in pH and DO was caused by the decline in photosynthesis process. In contrast, Lobson et al. (2018) disagreed with our results and detected that there were no significant difference in water quality parameters before and after thiamethoxam application. Moreover, Oghale et al. (2021) mentioned that water quality parameter showed no significant difference between the control and dimethoate treated groups with regard to pH, dissolve oxygen, temperature, electrical conductivity, total alkalinity and total dissolve solid (TDS).
2. Growth rate and weight gain of Nile tilapia:
Fish growth is considered one of the most important biomarkers for fish toxicity. The presented data in Table (2) and Fig. (2) showed the effect of thiamethoxam insecticide on growth rate of Nile tilapia. Statistically, there was a significant difference in final weight and weight gain of all treatments when compared with the control group. In addition, the lowest significance in the final weight and weight gain was observed at the high chronic dose while there was no significant change between both subacute doses.
It was recorded that the final weight decreased with increasing the chronic dose of thiamethoxam when compared with control group, with no observed impact in case of the 96h subacute treatment. The decreased growth and weight gain in fish in our study may be resulted from abnormal metabolism resulted from the stress response caused toxicity of thiamethoxam and decreased feed intake also decreased genetic expression of growth related hormones (ghrelin hormone) as we previously measured. Also, our findings were agreed by Dawood et al. (2020) who demonstrated a marked reduction in Nile tilapia weight gain, specific growth rate, final body weights and survival rate when exposed to a subacute dose of deltamethrin (15 μg/L) for 30days. Also Abdel-Tawwab et al. (2021) showed an agreement with our results as they pointed out a significant decrease in growth parameters of imidacloprid intoxicated Nile tilapia when compared to untreated group as a consequence of 8weeks exposure to 0.0 or 0.05 μg /L imidacloprid (IMI).
In addition, the reduced growth rates and final weights may be attributed to metabolic alterations caused by stress resulted from insecticides toxicity as the energy reserves was consumed by the intoxicated organism to counteract the harmful impact of the toxic substance or to activate its repairing mechanism resulting in impairing the metabolism of protein and carbohydrates. In conclusion, the energy required for growth was decreased (Khalil et al., 2017).
On the other hand, Zhu et al. (2019) disagreed with our results as he found that there was a significant reduction in body length of male Chinese rare minnow when applying thiamethoxam at 50 μg/L (p < 0.05), whereas, weight and hepatosomatic somatic index
(HSI) were significantly increased at 0.5 μg/L (p < 0.05) compared with the control condition.
In contrast, in females, the body length was markedly decreased in all treatment groups compared with the control group (p < 0.05), while there were no significant variations in other parameters, including weight and HSI. Similarly, RANIA and
NEDJOUA (2023) observed that there wasn’t any significant variation in growth of fresh water fish Alburnus alburnus fries exposed to thiamethoxam.
3. Impact of thiamethoxam on biochemical indices in Nile tilapia:
Serum biochemical indices have a key importance in detection of illnesses and toxicity in fish as they are indicators of the damage of various organs in the body of fish.
The observed data in Table (3) and Fig. (3) revealed the effect of thiamethoxam on serum proteins, Statistically, there was no significant change between different treatments and the control one. It was estimated that serum protein increased with increasing thiamethoxam concentration when compared to the control one (4.39 g/dl). Eventually, our results run parallel with Mukherjee et al. (2022) that observed a significant rise of serum protein in fresh water fish Clarias batrachus as compared to the un intoxicated group when exposed to the sublethal doses (6.93, 13.86 mg L−1) of thiamethoxam. As well Prakash (2020) supported ours by finding an elevation in Serum protein in Chlorpyrifos exposed Heteropnetues fossilis (Bloch) after exposure for 96 hours. In brief, the elevated serum protein content in fish may be attributed to the synthesis of important enzymes needed to detoxify toxic agents when they are stressed. It is also a general adaptive mechanism performed under toxicant stress (Bharti & Rasool, 2021).
However, results illustrated by Veedu et al. (2022) disagreed with ours as they detected a reduction in plasma protein levels as a result of use individual and binary mixtures of acetamiprid and thiamethoxam treatments in the freshwater fish Catla catla. In the same vein, Américo-Pinheiro et al. (2019) observed a marked reduction of total proteins in Nile tilapia exposed to imidacloprid.
Similarly, data illustrated in Table (3) and Fig. (4) demonstrated the effect of thiamethoxam insecticide on serum albumin (SA). Statistically, thiamethoxam had no significant change on SA at different treatments as well there was no difference between them and the control group. Additionally, results showed a raise in albumin concentrations as the concentrations of thiamethoxam increased as compared with untreated group.
Clearly, our results were supported by Fathy et al. (2019) who concluded that when exposing Nile tilapia to different herbicides, they induced a significant increase in levels of cholesterol, albumin, globulin, albumin/globulin (A/G) ratio.
Moreover, Sharafeldin et al. (2015) pointed out a marked increase in albumin and A/G ratio in Nile tilapia intoxicated with Profenofos insecticide, in addition they supposed that elevated serum albumin was caused by Impairment of kidney functions which were estimated that might resulted in albumin level imbalance and failure of stressed albumin excretion.
In contrast, Ilahi et al. (2018) results disagreed with ours as they found a marked decrease in serum albumin level of imidacloprid exposed groups of grass carp and golden fish when they were subjected to 2 ppm concentration for 28 and 24 days. Additionally, Kumar et al. (2010) demonstrated a negative impact of thiamethoxam insecticide on serum albumin in the fresh water fish Channa punctuates.
Additionally, data exhibited in Table (3) and Fig. (5) revealed the effect of thiamethoxam on serum globulin (SG) in Nile tilapia. Statistically, thiamethoxam did not cause a significant difference between the control group and both chronic and subacute treatments. While there was a significant difference in SG level between both chronic and subacute doses with the lowest significance observed in the low subacute treatment. Moreover, there was an observed elevation in globulin level with increasing thiamethoxam doses in chronic treatments while it decreased in 96h subacute dose.
Obviously, Our results showed an agreement with Raibeemol and Chitra (2018) who demonstrated a dramatic increase in protein and globulin levels in the freshwater fish, Pseudetroplus maculatus subjected to chlorpyrifos at two sublethal concentrations (0.661 µg/L, 1.32 µg/L) for 15 and 30 days. Moreover, Mukherjee et al. (2022) supported our findings as they found that Clarias batrachus experienced an elevation in globulin levels when fish exposed to sublethal (6.93, 13.86 mg L−1) and chronic (6.93, 13.86 mg L−1) doses of thiamethoxam insecticide. This elevation in serum globulin level was resulted from alterations in fish immunity (Gopal et al., 1997).
In contrast, El-bouhy et al. (2023) disagreed with our results as they detected a marked decrease in globulin concentrations in Grass carp exposed to 21days 1.8 µg/ L and
3.6 µg/ L of Profenofos. Additionally, Ilahi et al. (2018) found that serum globulin level was reduced in both grass carp and golden fish subjected to 2 ppm of imidacloprid for 28 and 24 days.
Generally, albumin is required for transportation of organic substances inside the body and is synthesized from liver while globulin is needed for immunity and synthesized from various organs. Our possible explanation for the elevated serum albumin in our study may be attributed to its antioxidant effect (non-enzymatic antioxidant) as it protects against tissue damage induced by thiamethoxam toxicity also it may be due to poor nutritional state induced by stress on fish. Also, elevated serum globulin may be due to immune response induced by fish body to overcome the damaging action of thiamethoxam on different organs (inflammatory response). Lastly, as a result of the elevation in both albumin and globulin, protein levels also increased as it consists of both of them. Moreover, the same trend of increasing serum proteins, albumin and globulin was observed in male albino rats treated with mixture of Imidacloprid and Fipronil pesticides at different concentrations for 28days (Badawy et al., 2018).
Regarding Table (3) and Fig. (6), data showed the effect of thiamethoxam insecticide on creatinine concentration in Nile tilapia. Statistically, there was a significant difference between high chronic dose and high subacute dose as compared to the control group, in addition the highest significant regarding creatinine level was observed at the high subacute dose while the lowest significant was at the low subacute one. Moreover, our results reported that creatinine levels increased as thiamethoxam concentrations increased with a slight decrease in the 96h low subacute dose when compared to the untreated group (0.88mg/dl).
These current results agreed with El Euony et al. (2020) findings in which they detected a dramatic elevation in serum creatinine level in African catfish subjected to 5 mg /l thiamethoxam for one month. Similarly, AbdelTawwab et al. (2021) found that Nile Tilapia experienced an exceptional elevation of serum creatinine 0.05 μg/L imidacloprid.
Interestingly, Amin and Hashem (2012) explained that the elevation in serum creatinine might be caused by glomerular disorders or increased breakdown of renal tissue, or decreased clearance by urine through the kidney. However, bentazon and halosulfuronmethyl herbicides resulted in non-significant decrease in creatinine level in Nile tilapia when exposed to sub-lethal concentrations of these herbicides for 96h as supposed by Fathy et al. (2019).
The data announced in Table (3) and Fig. (7) showed the effect of thiamethoxam insecticide on urea level in Nile tilapia. Statistically, there were no significant differences between the control group and subacute doses while there was a high significance observed at the high chronic dose compared to other treatments. Furthermore, thiamethoxam resulted in increased urea level in both chronic doses while it decreased urea concentrations in both subacute doses. However, increased urea levels in chronic doses use runs parallel to Bharti and Rasool (2021), as they detected an elevated levels of urea in Channa punctatus after exposure to malathion for 12days as a consequence of renal dysfunction. As well, it was detected in the fresh water fish Labeo rohita which experienced an increased urea levels when subjected to thiamethoxam insecticide at 0, 0.5, 1.0, 1.5, and 2.0 mg/L for 120h (Hussain et al., 2022).
A possible explanation to increased urea levels was clarified by Temiz and Kargın (2023) that elevated urea levels in fish serum was resulted from kidney failure. In contrast, the decreased urea levels in subacute doses was supported by Khan et al. (2019) who detected a significant reduction (P < 0.05) in urea levels in common carp after exposure to sub-lethal doses of endosulfan (0, 1, 3, 5 and 7 ppb) for 96h.
In the same vein, Taheri Mirghaed et al. (2018) observed a reduced serum urea levels in Cyprinus carpio intoxicated by 3 mg/L indoxacarb after 21 days. It was supposed that the reduced serum urea was attributed to decreased protein catabolism as plasma urea is an indicator of protein metabolism (Stoskopf, 1993; Yousefi et al., 2016).
Creatinine and urea are both considered as byproducts of protein metabolism. Creatinine is produced from creatine metabolism in muscle tissues. Both of them are filtered in urine through kidney. So elevation of both urea and creatinine may be as a result of renal failure caused by thiamethoxam toxicity. Also urea elevation may be resulted from gills dysfunction as fish gill is considered as a main route of its excretion. Moreover, decreased urea also in our results could be due to decreased liver synthesis of urea due to its severe damage or as a result of inadequate protein intake from the poor nutrition or may be from decreased protein metabolism.
The illustrated data in Table (3) and Fig. (8) has highlighted the effect of thiamethoxam insecticide on glucose level in Nile tilapia. Statistically, no significant differences were detected between all the treated groups and the control group as well. However, Serum glucose level was found to be increased with raising thiamethoxam concentration. In our study, glucose in general is considered one of the biomarkers for stress conditions in fish. Moreover, this increase in glucose level may be as a result of increased glycogenolysis and gluconeogensis caused by increased hormonal activities as a result of stress induced by thiamethoxam toxicity in fish. However, this increased glucose trend was also found in Clarias batrachus intoxicated by 1.65 mg/l chlorpyrifos (CPF) and 2.14 mg/l monocrotophos (MCP) for 3, 6, 9,12 and 15 days (Narra et al., 2017).
Similarly, Veedu et al. (2022) found an increased serum glucose level in Catla catla fish subjected to various concentrations of acetamiprid (0.5 mg/L and 1 mg/L), thiamethoxam (0.01 mg/L and 0.5 mg/L) and a mixture of them both (0.5 mg/L of acetamiprid and 0.01 mg/L of thiamethoxam) for 96 h.
Obviously, Fırat et al. (2011) possibly explained that, elevated glucose level is a sign of carbohydrate metabolism disruption, Perhaps as a result of enhanced liver glucose 6phosphatase activity, increased liver glycogen breakdown, or glucose synthesis from extrahepatic tissue proteins and amino acids. On the other hand, El-bouhy et al. (2023) results showed a marked elimination of serum glucose in Grass carp treated with 1.8 μg/ L and 3.6 μg/ L Profenofos for 21days. Furthermore, Mutlu et al. (2015) found a reduced glucose level in Nile tilapia exposed to 1.5 mg/L copper sulfate for 35, 65 and 95 days.
The data presented in Table (3) and Fig. (9) represented the effect of thiamethoxam insecticide on alanine transaminase (ALT) level in Nile tilapia. Statistically, there were no differences in ALT level between all treatment doses and the control group except for the high chronic dose, besides it showed the highest significance of all treatments. However, thiamethoxam intoxication resulted in raising of both ALT and AST levels with no detected change in ALT level in 96h subacute doses while AST level slightly decreased in low chronic dose.
It is well-known that ALT enzyme is found in liver and involved in converting protein into energy for liver cells whereas AST is produced from cells of liver, heart, skeletal muscles, kidney, pancreas and brain, it is involved in body breakdown of amino acids. Elevating both enzymes in our findings could be attributed to their leakage from liver cells into blood stream as a result of cells breakdown may be as a result of free radicals produced from thiamethoxam toxicity. Our results run parallel with Desai and Parikh
(2013) results as they demonstrated an increased levels of ALT and AST enzymes in Oreochromis mossambicus and Labeo rohita treated with sublethal doses (LC50/10 and LC50/20) of imidacloprid for 21 days.
In addition, Nile tilapia subjected to 0.05 μg/L imidacloprid has experienced a marked elevation in ALT and AST enzymes levels (AbdelTawwab et al., 2021). Moreover, Plasma ALT, AST increased in Nile tilapia subjected to 10.0 ppb chlorpyrifos
(CPF), Abamectin (ABM) and Emamectin benzoate (EB) for 48 and 96 h (Fırat & Tutus, 2020).
Additionally, Borges et al. (2007) suggested that ALT and AST are considered to be indicator enzymes for liver health. So, the activities of both enzymes when increased in the serum of fish, it may be related to liver necrosis and hepatocellular dysfunction. In contrast, El-bouhy et al. (2023) found decreased levels of AST and ALT enzymes in Grass carp intoxicated by 1.8 μg/ L and 3.6 μg/ L Profenofos for 21days. As well, Sapana Devi and Gupta (2014) exposed Anabas testudineus to deltamethrin and permethrin at sublethal concentrations of 0.007 and 0.0007 mg L−1, and 0.093 and 0.0093 mg L− for 21days and they found a dramatic decrease in AST level in liver and muscle tissues and ALT in muscle tissue of deltamethrin treated fish only.
The represented data in Table (3) and Fig. (11) revealed the effect of thiamethoxam insecticide on cholesterol level in Nile tilapia. Statistically, no significant differences observed between the treatments groups also between them and the control group. On the other hand, serum cholesterol expressed an increase in its level only in 3weeks chronic doses while it decreased in the 96h subacute doses when compared to control group.
The trend of elevating cholesterol level runs parallel with Hussain et al. (2022) as he found an elevated cholesterol level in Labeo rohita intoxicated with thiamethoxam insecticide at 0, 0.5, 1.0, 1.5, and 2.0 mg/L for 120h. Additionally, juvenile catfish treated with dimethoate at sub-lethal concentrations (0.01, 0.15and 0.29 mg/l) for 28 days experienced increased cholesterol levels at the lower exposure concentration. Possibly, The impairment in cholesterol level resulted from serious Lipid metabolism impairment in fishes caused by insecticide exposure (Oghale et al., 2021).
However, reduced levels of cholesterol in our results was also observed by Remia et al. (2008) as they treated Tilapia mossambica fish with a median lethal concentration of Monocrotophos insecticide for 24, 48, 72 and 96hours. Similarly, catfish (Clarias lazera) exposed to deltamethrin (DM) at 0.5 ug/L, for one week, and 0.02, and 0.01 ug/L for 4 weeks, experienced a marked decrease in serum total cholesterol and serum total lipids (TL) level after one week exposure to the concentration 0.5 ug/L of DM (Aziz et al., 2009).
According to Ganeshwade (2012) Cholesterol content was decreased during pesticides exposure in ovaries and liver when measured might be as a result of general damage, blockage of enzyme system for Steroidogenesis in ovary and the capacity of liver to store Cholesterol due general damage.
The demonstrated data in Table (3) and Fig. (12) explained the effect of thiamethoxam on triacylglycerol (TAG) level in Nile tilapia. Statistically, there were no significant differences between various treatment groups and the control one with exception to the low subacute dose that had the lowest significant change of all treatments. Furthermore, thiamethoxam intoxication resulted in decreased TAG levels when compared to control group with exception to the high chronic dose that resulted in a little increase of TAG level with no detected change in high subacute dose. The decreased level of TAG was also found in Clarias lazera exposed to deltamethrin (DM) at 0.02 ug/L for 4weeks (Aziz et al., 2009).
Furthermore, Osuna-Flores et al. (2019) detected that exposing the white shrimp
Litopenaeus vannamei for 7days to 0.0015 mg l−1 chlorpyrifos, 1.207 mg l−1 methamidophos, 0.0101 mg l−1 azinphos-methyl and 0.0075 mg l−1 methyl parathion has led to reduced triglycerides levels.
In addition, Logaswamy and Remia (2009) observed a marked decrease in triglycerides levels in Tilapia mossambica treated with median lethal dose of cypermetherin and Ekalux for 24h. However, the increased level of TAG observed in our results was also found in freshwater fish Labeo rohita intoxicated by thiamethoxam at sublethal doses (0, 0.5, 1.0, 1.5, and 2.0 mg/L) for 120h as found by Hussain et al. (2022).
Obviously, Ismail and Mahboub (2016) supposed that the rise in serum triglyceride levels may be attributed to the increased utilization of triglycerides. This phenomenon may occur to fulfill the energy requirements necessary for a plethora of causes like overcoming the damage inflicted by the xenobiotic, physical activity, biotransformation and finally elimination of the xenobiotic etc. In addition, Clarias batrachus subjected to 1.65 mg L_1 chlorpyrifos (CPF) and 2.14 mg L_1 monocrotophos (MCP) for various durations 3, 6, 9,12 and 15 days exhibited an elevated triglycerides levels (Narra et al., 2017).
The exhibited data in Table (3) and Fig. (13) clarified the effect of thiamethoxam insecticide on very low density lipoproteins (VLDL) level in Nile tilapia. Statistically, there were significant differences between various treatment groups and the control group except for both low chronic dose and high chronic dose that showed no significant changes with the lowest significance observed at the high chronic dose. However, VLDL level increased with increasing thiamethoxam dose except for the 96h low subacute dose.
This currently increased level of VLDL in our results was also detected by Saqer et al. (2019) in males of white mice subjected to Imidacloprid (IMI) at different doses (0, 2.8, 5.4 and 10) ppm for 30days. As well Hemat K. Mahmoud et al. (2022) detected an enhancement in VLDL levels in Nile tilapia treated with sub-lethal dose of fipronil (4.2 µg L−1 for 3 h only per day) for 8 weeks. On the other hand, VLDL levels was found to be decreased in common carp exposed to low (0.15 mg/L, 0.3 mg/L, 0.6 mg/L) of phosalone pesticide for 14 days (Kaya et al., 2015). It was possibly explained that the increased total cholesterol, TGs, LDL, and VLDL in the insecticide intoxicated fish can be caused by the detrimental effect of these pesticides on the liver’s lipid metabolism, which raises the blood lipid levels as a result (Yousef et al., 2003; Öner et al., 2008).
The represented data in Table (3) and Fig. (14) explained the effect of thiamethoxam on high density lipoproteins (HDL) level in Nile tilapia. Statistically, there were no significant differences in HDL levels between treatment groups and control one except for the high subacute dose which had the highest significance and the high chronic dose which represented the lowest significance. Furthermore, thiamethoxam was found to decrease the HDL level by increasing the treatment dose as compared to the control group except for the 96h subacute dose that increased HDL level. The reduced HDL levels trend runs parallel with Esenowo et al. (2022) as they detected a significant decrease in HDL levels in Clarias gariepinus juveniles exposed to 5, 7, 9, 11 and 15 mgL-1 chlorfenapyr for 96 h.
However, Bal et al. (2010) clarified that the harmful effect of neonicotinoid pesticides in increasing the level of cholesterol due to oxidative stress, and cholesterol is the former precursor of the formation of steroids that are produced in the liver by HDL and low-density lipoprotein (LDL), also Duzguner and Erdogan (2012) reported that IMI had a negative effect against the liver due to oxidative stress on liver cell tissue, affecting HDL and LDL. On the other hand, Fırat et al. (2011) detected an elevation in HDL levels in
Oreochromis niloticus subjected to 0.05 μg/l cypermethrin (CYP) for 4 and 21days. Furthermore, Mokhbatly et al. (2020) found an increased level of HDL in African catfish intoxicated by 1.5 mg/L Chlorpyrifos (CPF) for 60days.
Regarding the data presented in Table (3) and Fig. (15), it illustrates the effect of thiamethoxam insecticide on low density lipoproteins (LDL) levels in Nile tilapia. Statistically, no significant differences observed in LDL levels between thiamethoxam treated groups and control group. Our Findings revealed that LDL levels increased in both low chronic and subacute dose while it decreased in both high chronic and subacute doses when related to the untreated group.
In our results, elevated LDL levels were also detected in Nile tilapia subjected to 1.5 mg/L copper sulfate for 35, 65 and 95 days (Mutlu et al., 2015). In the same vein, African catfish subjected to Chlorpyrifos (CPF) at 1.5 mg/L for 60days exhibited an increased LDL concentrations compared to control group (Mokhbatly et al., 2020). Additionally, Kojima et al. (2004) attribute the increased LDL levels to changes in gene expression of some hepatic enzymes like HMG-CoA reductase (hydroxyl-methylglutaryl- CoA), which would suppress LDL-receptor gene expression.
Cholesterol and TAG are types of body lipids, but cholesterol are formed in all body cells, help in formation of steroid hormones, maintains the health of nerve cell and enter in synthesis of vitamin D while TAG is involved in energy production inside the body. Increased cholesterol levels may be indicative of kidney and liver disorders also cholesterol level may increase as a result of stress response in synthesis of steroid hormones. Decreased both of them may be attributed to impairment in lipid metabolism and malnutrition induced from stress response. When cholesterol (fats) binds with protein it’s called lipoprotein. Increased HDL may be as a result of liver cells damaging also increased LDL and VLDL may be as a result of liver and kidney disorders. Decreased HDL maybe as a result of liver and intestinal disorders induced by oxidative damage due to thiamethoxam toxicity also as a result of inflammatory response.
4. Impact of thiamethoxam on oxidative stress biomarker:
The data exhibited in Table (4) and Fig. (16) clarified the effect of thiamethoxam insecticide on serum oxidative stress parameters in Nile tilapia. Statistically, there were no significant differences in super oxide dismutase (SOD) levels between thiamethoxam treated groups and the control group. Moreover, for malondialdehyde (MDA), no significant differences observed between the treated groups but there was significant difference between them and the control group. Furthermore, there were no significant differences in total antioxidant capacity (TAC) levels between thiamethoxam treated group and control group while the lowest significance observed was at the high subacute dose.
However, thiamethoxam treatment resulted in decreasing the SOD levels in relation to the control group which was 3.27U/ml. SOD is one of the important antioxidant enzymes and is considered the first line defense mechanism against free radicles as it converts superoxide radicals into hydrogen peroxide and molecular oxygen. Decreased SOD levels in our study may be attributed to depletion of the enzyme resulted from elevated ROS levels that induce cell damage. In contrast, THX treatment caused an elevation in MDA levels when compared to the control group (1.05mM/ml). MDA is produced from lipid peroxidation as a result of oxidative stress induced by pollutants exposure in fish, so elevated MDA levels in fish is a strong indication of oxidative damage of different body cells. Obviously, TAC levels decreased as THX treatment concentrations increased in relation to control group.
TAC measures the amount of antioxidants inside fish body and its decrease in our study may be indicative of elevated free radicals induced by thiamethoxam induced oxidative stress in fish and depletion of antioxidants that help in their prevention. Our results run parallel with Yan et al. (2016) as they detected a slight increase in MDA activity on days 21 and 28 in zebrafish exposed to 0.30, 1.25, and 5.00 mg/L thiamethoxam for 7, 14, 21 and 28days. On the other hand, Ensibi et al. (2012) exposed common carp to carbofuran at 0, 10, 50, or 100 µg L−1 for 4, 15, or 30 days and found that carbofuran decreased the MDA content in fish liver. Additionally, Nile tilapia exposed to 477.29 mg/L, 2.901 µg/L thiamethoxam and lambda cyhalothrin individually and in mixture for 7 and 15 days exhibited reduced levels of TAC (Kocamaz & Oruc, 2018).
In addition, Hamed and Osman (2017) demonstrated a dramatic enhancement in hepatic and renal MDA and SOD levels and marked decrease in TAC levels in African catfish exposed to 0.121 mg/L carbofuran (CF) for 4 weeks. Moreover, Günal et al. (2019) found a marked elevation in MDA levels with an observed reduction in SOD levels when exposing Nile tilapia to sublethal concentrations of imidacloprid insecticide (50 and 100 mg/l) for 24 and 96 h.
In contrast, El-Garawani et al. (2021) observed an elevation in the activities and gene expression of SOD in Nile Tilapia exposed to 8.75 ppm and 17.5 ppm of imididacloprid for 21days. According to Veedu et al. (2022), the decrease in Superoxide dismutase (SOD) level was an adaptive response of fish to the insecticides as SOD is the first line in cellular defense against reactive oxygen species. Additionally, Amin and Hashem (2012) mentioned that, MDA are produced by LPO and considered as indicators of oxidative stress, which results from the free radical damage to membrane components of cells. Furthermore, H. K. Mahmoud et al. (2021) pointed out that the inhibition observed in TAC could be attributed to the deficient defense against ROS and the resulted H2O2 accumulation.
5. Impact of thiamethoxam on the histopathology of both gills and liver tissues of Nile Tilapia:
Thiamethoxam toxicity has showed typical changes in both gills and liver tissues which resulted in alterations in the functions of both organs that has led to the abnormal biochemical and genotoxic changes which typically affected fish survival and growth.
5.1. Gill tissue pathological changes:
According to our results in photos from (1 to 13) which illustrated the changes that happened in gill tissues including lamellar lifting and congestion of branchial blood vessel, eosinophilic granular cells (EGCs) infiltration, lamellar telangiectasis, filamentous clubbing, unilateral fusion of secondary lamellae, hemorrhages and lamellar lifting. Our results run parallel with Günal et al. (2019) who found that gill tissue of Nile Tilapia exposed to 50 and 100 mg/l imidacloprid for 24 and 96h has revealed epithelial lifting, fusion of secondary lamellae, telangiectasia and hyperaemia.
Also, El-Garawani et al. (2022) detected severe histopathological changes in the gills of Nile Tilapia as they were edematous and suffered from hyperplasia, hemorrhage, and fusion of the secondary lamellae where fish exposed to 19.5 ppm Acetamiprid for 21days. Besides, Georgieva et al. (2014) supported our results by detecting that common carp gills after intoxication by 6.6, 10 and 20 mg/l thiamethoxam have shown lamellar lifting, edema, proliferation of the glandular cells and epithelium covering the gill filament, fusion and degenerative changes with Vasodilatation of the blood vessels.
5.2. Liver tissue histopathological changes:
Regarding our findings in photos from (14 to 24), typically thiamethoxam intoxication in Nile Tilapia has led to pathological changes in liver tissue with no detected change in the control group including congestion of central veins, diffuse hydropic degeneration of hepatocytes, activation in melanomacrophage centers (MMCs) and vacuolation of hepatocytes.
Our results were supported by El Euony et al. (2020) as they pointed out that liver tissue of African cat fish exposed to 5mg/l TMX for 1 month has suffered from vacuolation of hepatocytes that was of hydropic and fatty type with pyknotic and eccentric nuclei, hepatocellular necrosis with mononuclear cell infiltrations, and perivascular mononuclear cell infiltrations, hemorrhage, and MMCs activation. Moreover, Ansoar-Rodríguez et al. (2016) found that Nile Tilapia liver has revealed histopathological changes including hydropic degeneration with pyknotic nucleus, cytoplasmic vacuolations and loss of cell limits, when fish were subjected to imidacloprid at 250, 125 and 62.5 mg/l after 96h.
Similarly, Hasan et al. (2023) showed that liver tissue in Banded Gourami exposed to thiamethoxam (9.37, 18.75, 37.5, 75, and 150 mg/L) for 90 days, has shown histopathological changes ranging from acute cellular swelling and fatty changes to vacuolation, autolysis and necrosis.
6. Gene expression by RT-PCR:
Data illustrated in Table (5) and Fig. (18) identified the impact of thiamethoxam insecticide on growth related (ghrelin), immunity (TLR2) and stress (CAT) genes expression in liver of Nile tilapia. Statistically, there were significant differences detected in the expression of the three genes between all Thiamethoxam treated groups and the control one. In addition, the lowest significance regarding ghrelin and catalase (CAT) expression was observed at the high subacute dose, while the lowest one regarding toll like receptors 2 (TLR2) genes was at the low chronic dose. Moreover, there was a significant upregulation in TLR2 gene expression while that of both ghrelin and CAT was significantly down regulated.
The demonstrated findings revealed that fold change mean value for growth related genes (ghrelin) decreased by increasing the dose of thiamethoxam when compared to the untreated fish. Ghrelin hormone is involved in enhancement of appetite, induces release of growth hormone and has a role in regulation of insulin release. However, decreased ghrelin levels in our study could be attributed to the damage occurred in cells that are responsible for ghrelin production in the gut also may be as a result of gastroenteritis caused by thiamethoxam toxicity. In contrast, results for fold change mean value of immunity genes (TLR2) showed a marked elevation with increasing thiamethoxam dose compared to nonintoxicated group.
Elevated levels of TLR2 (innate immunity) genes may be as a result of adaptive response against the oxidative stress in fish caused by thiamethoxam toxicity. Lastly, the genetic expression of oxidative stress gene (CAT) showed a dramatic decrease with elevating thiamethoxam concentrations in water. CAT act on hydrogen peroxide produced by SOD and converts into water and oxygen so it’s considered one of the important enzymes involved in free radicals scavenging, the decreased CAT levels may be as a result of elevated levels of ROS that caused damage in liver cells so prevent them from cat synthesis also it may be resulted from an adaptive response of the body against stress induced by thiamethoxam toxicity.
The decreased expression of ghrelin gene trend was also found in Carassius auratus gibelio exposed to Cadmium (Cd) at 1, 2, and 4 mg/L for 30 days (Cai et al., 2020). Also they found that found that Cd exposure led to significant changes in the expression levels of neurohormone-related genes (gherlin) in the brain, which might also explain the observed changes in food intake and weight in the Cd-exposed fish.
Furthermore, Lal et al. (2013) found elimination in the levels of growth hormone (GH) and thyroxine (T4) in catfish when they are subjected to Malathion at 0.001 ml/liter and 0.0001 ml/liter. Our results disagreed with Marlatt et al. (2019) as they found no significant effect on expression of growth genes of embryonic, alevin and early swim-up fry sockeye salmon exposed to 0.15, 1.5, 15 and 150 μg/L clothianidin for 4months. However, the increased trend of gene expression of TLR2 runs parallel with Zhao et al. (2020) as they found an upregulation in transcriptional level of genes enter in Toll-like receptors (TLR) in grass carps spleen when fish exposed to 0.651 μg/L cypermethrin and 0.3 μg/L sulfamethoxazole for 42 days.
In addition, gene expression of Toll-like receptors (including TLR1 and TLR2) were dramatically upregulated in Chinese mitten crab exposed to 0 µg/L, 150 µg/L and 300 µg/L of thiamethoxam for 96h (Yang et al., 2023). On the other hand, Tang et al. (2021) supposed that crucian carp exposed to 300 μg/L diazinon for 21 days exhibited significant downregulation (P < 0.05) in gene expression of TLR4, MyD88, NF-kB p100 and IL-8 while there was no significant change in TNF-α. In their study, they concluded that 24h intoxication by thiamethoxam exceptionally upregulated the expression levels of TLR1, TLR2 suggesting that thiamethoxam exposure might induce inflammation in juvenile E.
sinensis via NF-κB signaling pathway.
Moreover, decreased catalase mRNA content was also supported by Tian et al. (2020) as they found a dramatic down regulation of catalase gene in juvenile Chinese rare minnows when exposed to exposed to 0.1, 0.5, or 2.0 mg/L imidacloprid, nitenpyram, and dinotefuran for 60 days.
Additionally, Ahmed et al. (2022) found a marked down regulation of the antioxidant enzymes (sod and cat) gene expression in Nile tilapia liver when fish exposed to 1.39mg/l atrazine. In contrary to this, El-Garawani et al. (2021) detected that mididacloprid intoxicated Nile tilapia exhibited an increase in the expression and activities of SOD, CAT in fish liver.
7. Thiamethoxam residues concentrations in fish flesh:
Data represented in Table (10) and Fig. (22) showed thiamethoxam residues in Nile tilapia muscles reared under different levels. Statistically, there were significant differences in thiamethoxam residues between various treatment groups and control group with highest significance detected at the high subacute dose. Moreover, thiamethoxam residues were obviously detected at the control group (0.090mg/kg), with its value increased with increasing thiamethoxam treatment dose.
Our results have showed an agreement with Abd El-hameed et al. (2021) who found increased residual imidacloprid (IMID) levels in Nile tilapia flesh and liver tissues after exposure to a sub-lethal dose of IMID (0.0109 μg/L) for two weeks. As well Zhang et al. (2023) supported our results by finding dramatic increase in TMX residual content in the muscle and Hepatopancreas of red swamp crayfish subjected to 10 ppt of thiamethoxam insecticide for 7days.
In our current results thiamethoxam residual content was also detected in the control group which indicates that most Egyptian farm use water may be contaminated by residues of insecticides and pesticides as the control group residual thiamethoxam exceeded the permissible levels for human consumption (0.01mg/kg) according to the Reference lab for Ministry of Agriculture Accredited according to ISO/IEC17025 by FINAS.
8. Thiamethoxam effect on mortalities:
Data displayed in Table (11) and Fig. (23) clarified the impact of thiamethoxam insecticide on survival of Nile tilapia. Statistically, there were no significant differences in mortalities between various treatment groups and the control group with exception to high subacute dose that showed the highest significance of all groups. In fact, mortalities were increased with increasing thiamethoxam dose, with no mortalities observed in the control group. Individual mortalities in our results may be caused by exhaustion of all adaptive mechanisms to overcome the stress induced by toxicity of thiamethoxam in fish.
Our results run parallel with Albinati et al. (2016) who found a direct relationship between mortalities rates of Nile tilapia fingerlings and increased thiamethoxam insecticide concentration when exposing fish to 150, 300, 450, 600 and 750mg / L Actara. Moreover, Sabra and Mehana (2015) mentioned that when is the launch of large quantities of pollutants there might be an immediate impact as measured by mortality the sudden largescale aquaculture, for example, fish kills caused by pollution of water ways with agricultural pesticides. Lower levels of discharge may result in accumulation of pollutants in aquatic organisms.
6. Summary
The present study was carried out in Fish Diseases Department, Animal Health Research Institute, Alexandria branch, Egypt to evaluate the effect of water pollution by thiamethoxam insecticide on health condition of Nile tilapia (Oreochromis niloticus). The used insecticide was Actara 25 WG manufactured by Sygenta, Egypt and it was purchased from Egyptian Company for Seeds and Agricultural Chemicals. It composed of 250 g/kg thiamethoxam, 3-(2chloro-thiazol-5-ylmethyl)-5-methyl-(1,3,5) oxadiazinan-4-yldene-Nnitroamine and 750 g/kg inert ingredients.
A total of 200 O. niloticus with an average initial weight of 15 ± 5 g have been obtained from a commercial fish farm in Kafr Elsheikh province, Egypt. They were placed upon arrival in 100 L glass aquaria provided with artificial aeration. Fish were kept for acclimatization for seven days in chlorine free water where they were given feed twice daily. Fish were given pelleted feed (30 % crude protein at a rate of 3% of fish body weight). A biweekly partial water exchange was applied with the help of siphoning tube that remove wastes and feed residues from all the aquariums and keep them clean as much as possible. After that, fish were randomly allotted to five replicated treatments. They were kept at a density of 10 fish / aquaria. Four different concentrations of the insecticide were tested with three replicates of fish for each treatment (25 mg/l, 50 mg/l, 100 mg/l and 250 mg /l) beside no insecticide in the control group.
The results regarding water quality parameters pH, dissolved oxygen levels (DO), oxygen saturation percentage (DO%) and salinity showed significant differences between different thiamethoxam treated groups and the control group, where the lowest significance observed regarding the pH, DO and DO% was at the high subacute dose while in salinity it was at the high chronic dose with the highest significance at the high subacute dose.
The study findings related to fish growth rate and weight gain revealed a significant difference statistically in final weight and weight gain of all treatments when compared with the control group. In addition, the lowest significance in the final weight and weight gain was observed at the high chronic dose while there was no significant change between both subacute doses.
Serum biochemical analysis results regarding to serum proteins analysis findings, there was no significant change between different treatments and the control one. It was estimated that serum protein increased with increasing thiamethoxam concentration when compared to the control one (4.39 g/dl). Similarly, for serum albumin (SA), thiamethoxam had no significant change on SA at different treatments as well there was no difference between them and the control group.
Concerning serum globulin (SG), thiamethoxam did not cause a significant difference between the control group and both chronic and subacute treatments. While there was a significant difference in SG level between both chronic and subacute doses with the lowest significance observed in the low subacute treatment. Additionally, thiamethoxam resulted in a significant difference in the mean value of serum creatinine between high chronic dose and high subacute dose as compared to the control group, in addition the highest significant regarding creatinine level was observed at the high subacute dose while the lowest significant was at the low subacute one. However, serum urea mean value has revealed no significant difference between the control group and subacute doses while there was a high significance observed at the high chronic dose compared to other treatments.
Regarding serum glucose level in Nile tilapia, statistically, no significant differences were detected between all the treated groups and the control group as well as a consequence of 3weeks thiamethoxam treatment, glucose level was observed to be increased with increasing the intoxication dose. In the same vein, thiamethoxam caused no significant differences in ALT levels between all treatment doses and the control group except for the high chronic dose, besides it showed the highest significance of all treatments. However, results of 3weeks treatment with thiamethoxam revealed an increase in ALT level by increasing the concentration of thiamethoxam.
Thiamethoxam insecticide impact on aspartate transaminase (AST) level in Nile tilapia caused no significant differences between the untreated group and other treated ones, however, there were a significant differences observed between both low chronic dose and high subacute dose than other treated groups with the lowest detected significance at the low chronic dose. Moreover, serum cholesterol levels in Nile tilapia exposed to thiamethoxam expressed no significant differences between the treatment groups also between them and the control group. On the other hand, thiamethoxam impact on serum triacylglycerol (TAG) levels in Nile tilapia have exhibited no significant differences between various treatment groups and the control one with exception to the low subacute dose that had the lowest significant change of all treatments.
For very low density lipoproteins (VLDL) level in Nile tilapia, there were significant differences between various treatment groups and the control group except for both low chronic dose and high chronic dose that showed no significant changes with the lowest significance observed at the high chronic dose. Furthermore, high density lipoproteins (HDL) level in Nile tilapia showed no significant differences in HDL levels between treatment groups and control one except for the high subacute dose which had the highest significance and the high chronic dose which represented the lowest significance. Lastly, thiamethoxam insecticide effect on low density lipoproteins (LDL) levels in Nile tilapia expressed no significant differences between thiamethoxam treated groups and control group.
For serum oxidative stress biomarkers, thiamethoxam adversely affected oxidative stress biomarkers in Nile tilapia. However, there were no significant differences in super oxide dismutase (SOD) levels between thiamethoxam treated groups and the control group. Moreover, for malondialdehyde (MDA), no significant differences observed between the treated groups but there was significant difference between them and the control group. Furthermore, there were no significant differences in total antioxidant capacity (TAC) levels between thiamethoxam treated group and control group while the lowest significance observed was at the high subacute dose.
Histopathological changes in both liver and gill tissues in Nile Tilapia revealed the toxic impact of thiamethoxam on fish as we found in our results that the control group expressed no pathological changes in both organs while for the exposed groups of fish gill tissues have revealed lamellar lifting and congestion of branchial blood vessel, eosinophilic granular cells (EGCs) infiltration, lamellar telangiectasis, filamentous clubbing, unilateral fusion of secondary lamellae, hemorrhages and lamellar lifting. Whereas liver tissues have shown congestion of central veins, diffuse hydropic degeneration of hepatocytes, activation in melanomacrophage centers (MMCs) and vacuolation of hepatocytes.
Concerning thiamethoxam insecticide impact on growth related (ghrelin), immunity (TLR2) and stress (CAT) genes expression in liver of Nile tilapia, there were significant differences detected in the expression of the three genes between all thiamethoxam treated groups and the control one. In addition, the lowest significance regarding ghrelin and catalase (CAT) expression was observed at the high subacute dose, while the lowest one regarding toll like receptors 2 (TLR2) genes was at the low chronic dose. Moreover, there was a significant upregulation in TLR2 gene expression while that of both ghrelin and CAT was significantly down regulated.
Thiamethoxam residues in Nile tilapia muscles reared under different levels were significantly different between various treatment groups and control group with highest significance detected at the high subacute dose. Moreover, thiamethoxam residues were obviously detected at the control group (0.090mg/kg), with its value increased with increasing thiamethoxam treatment dose.
Thiamethoxam resulted in absence of significant differences in mortalities between various treatment groups and the control group with exception to high subacute dose that showed the highest significance of all groups. In fact, mortalities were increased with increasing thiamethoxam dose, as no mortalities observed in the control group while during the 3 weeks treatment; some individual mortality was observed firstly at the low chronic dose (25mg/l) and recorded to be nearly 0.66 as a mean value for mortalities where as in the high chronic dose (50mg/l) it reached 1. On the other hand, during the use of 96h subacute treatments, mean values of mortalities elevated to be 1.33 in low subacute (100mg/l), whereas it was 2 in high subacute dose (250mg/l) which was the highest recorded value of all treatments.
Conclusion
7. Conclusion and Recommendations
It seems that thiamethoxam is considered one of the low toxicity neonicotinoid insecticides which made it very popular to be used as pesticide in many areas around the world, but unfortunately, results of our current study argued that it had harmful effects in aquatic non targeted organisms.
Our studies proved that as it has disturbed both serum biochemical and oxidative stress biomarkers in Nile tilapia which are very important in toxicity detection in fish. As a consequence, thiamethoxam affects liver, kidney, gills and heart integrity as well as it has negative impact on fish metabolic activity. Additionally, histopathological changes observed in both gills and liver supported these harmful effects. Moreover, our current study has proved that this insecticide has adverse impact on both survival and growth of Nile tilapia fish, as growth and survival of Nile tilapia was found to be decreased with elevating thiamethoxam dose. Furthermore, these adverse impacts were also found at molecular level when we detected changes in gene expression of some important genes (genes related to stress, growth and innate immunity) in liver tissues. Finally, we detected that it could affect human health by its accumulation in edible flesh in fish.
Some possible recommendations to be considered:
• Periodical analysis of water bodies for pesticides residues by using HPLC to detect if there is a leakage in water that can be very harmful and may lead to mass deaths in fish.
• Fish farms should avoid using water from agricultural drainage in fish farming or they can treat this water before use if there is a water shortage from a clean source.
• It is recommended to use of aquaponics system as this system depends on a symbiotic relationship between fish and plants where fish wastes fertilize plants and in turn plants filter and clean the water for fish (clean system with low costs).
• Hygienic disposal of pesticide wastes and empty containers by burial in areas as far away as possible from water bodies and underground water (in deserts may be).
Conclusion
• Hygienic disposal of sewage water and wastes produced from plants or factories away from water bodies.
• Avoid frequent irrigation of the cultivated lands as it increases their reaching to water bodies.
• It is preferable to use pesticides that are well-known for their low toxicity to nontargeted organisms and to follow the directions written on the package or label of the pesticides carefully before application to avoid their adverse impact as possible.
• Avoid using pesticides on crops during rainy or stormy days to prevent them from reaching water bodies with rain water by running off.
• Pesticides should be stored in a locked storage place with impervious floors that prevent any kind of leakage also workers should periodically inspect the containers for any damage that can lead to pesticides spill or leakage.
• It is important to make the farmers and agricultural lands owners aware about the dangers of water pollution by pesticides.
• It is suggested to use various analytical tests (different biochemical tests, immunohistochemistry, RT-PCR examination for a range of important genes that are related to fish growth and survival, histopathological examination of different organs with special referencing to nervous system).
• Finally, we recommend making further studies on other fresh or marine water fish species also with a wide range of different doses.
8. References
Abd El Megid, A., Abd Al Fatah, M.E., El Asely, A., El Senosi, Y., Moustafa, M.M., Dawood, M.A., (2020). Impact of pyrethroids and organochlorine pesticides residue on IGF-1 and CYP1A genes expression and muscle protein patterns of cultured Mugil capito. Ecotoxicology and environmental safety, 188, p.109876.
Abd El-hameed, S. A. A., Negm, S. S., Ismael, N. E. M., Naiel, M. A. E., Soliman, M. M., Shukry, M., & Abdel-Latif, H. M. R. (2021). Effects of Activated charcoal on Growth, Immunity, Oxidative Stress Markers, and Physiological Responses of Nile Tilapia Exposed to Sub-Lethal Imidacloprid Toxicity. Animals, 11(5).
Abdel Rahman, A. N., AbdelMageed, M. A., Assayed, M. E. M., Gharib, H. S. A.-R., Nasr, M. A., Elshopakey, G. E., . . . Ahmed, S. A. A. (2023). Imidacloprid induced growth, hematological, neuro-behavior, anti-oxidant, economic, genetic, and histopathological alterations in Clarias gariepinus: Alleviative role of dietary Hyphaene thebaica. Aquaculture, 564, 739058.
Abdel-Tawwab, M., El-Saadawy, H. A., El-Belbasi, H. I., Abd El-Hameed, S. A. A., & Attia, A. A. (2021). Dietary spirulina (Arthrospira platenesis) mitigated the adverse effects of imidacloprid insecticide on the growth performance, haematobiochemical, antioxidant, and immune responses of Nile tilapia. Comparative Biochemistry and Physiology Part C: Toxicology & Pharmacology, 247, 109067.
Afifi, M., Ali, H. A., Saber, T. M., & El-Murr, A. e. (2016). Lethrinas nebulosus fish as a biomarker for petroleum hydrocarbons pollution in Red Sea: Alterations in antioxidants mRNA expression. Japanese Journal of Veterinary Research, 64(Supplement 2), S123-S129.
Ahmed, M. M., Mohammed, A. T., Farag, M. R., Hassan, M. A., Mawed, S. A., Alagawany, M., . . . Abdel-Latif, H. M. R. (2022). Dietary Supplementation of Nile Tilapia (Oreochromis niloticus) With Panax ginseng Essential Oil: Positive Impact on Animal Health and Productive Performance, and Mitigating Effects on Atrazine- Induced Toxicity. Frontiers in Marine Science, 9.
Albinati, A. C. L., Albinati, R. C. B., Lira, A. D., & Soares, P. C. (2016). Toxicidade aguda e risco ecotoxicológico do inseticida tiametoxam para alevinos de tilápiado-nilo. Arquivo Brasileiro de Medicina Veterinária e Zootecnia, 68.
Albinati, A. C. L., Soares, P. C., Moreira, E. L. T., Albinati, R. C. B., da Silva, A. L.,
& de Medeiros, S. D. C. (2020). Parâmetros bioquímicos de tilápia do Nilo
exposta ao tiametoxam. Research, Society and Development, 9(11), e92391110475-e92391110475.
Allain, C. C., Poon, L. S., Chan, C. S. G., Richmond, W., & Fu, P. C. (1974). Enzymatic Determination of Total Serum Cholesterol. Clinical Chemistry, 20(4), 470-475.
Américo-Pinheiro, J. H. P., da Cruz, C., Aguiar, M. M., Torres, N. H., Ferreira, L. F. R., & Machado-Neto, J. G. (2019). Sublethal Effects of Imidacloprid in Hematological Parameters of Tilapia (Oreochromis niloticus). Water, Air, & Soil Pollution, 230(8), 193.
Amin, K. A., & Hashem, K. S. (2012). Deltamethrin-induced oxidative stress and biochemical changes in tissues and blood of catfish (Clarias gariepinus): antioxidant defense and role of alpha-tocopherol. BMC Veterinary Research, 8(1), 45.
Ansoar-Rodríguez, Y., christofoletti, C. A., Correia, J. E., de Souza, R. B., Moreirade-Sousa, C., Marcato, A. C. d. C., . . . Fontanetti, C. S. (2016). Liver alterations in Oreochromis niloticus (Pisces) induced by insecticide imidacloprid: Histopathology and heat shock protein in situ localization. Journal of Environmental Science and Health, Part B, 51(12), 881-887.
Aziz, M., Hegazi, H., Abd EL-Khalik, M., & Taha, M. (2009). Effect of deltamethrin on liver and kidney function of Clarias lazera fish. Kafrelsheikh Veterinary Medical Journal, 7(1), 206-232.
Badawy, M. H., Ahmed, N. S., & Attia, A. M. (2018). Sub-acute oral toxicity of imidacloprid and fipronil pesticide mixture in male albino rats; biochemical and reproductive toxicity evaluation. Journal of Materials and Environmental Sciences, 9(6), 2431-2437.
Bal, R., Erdogan, S., Theophilidis, G., Baydas, G., & Naziroglu, M. (2010). Assessing the effects of the neonicotinoid insecticide imidacloprid in the cholinergic synapses of the stellate cells of the mouse cochlear nucleus using whole-cell patch-clamp recording. NeuroToxicology, 31(1), 113-120.
Baldissera, M. D., Souza, C. F., Golombieski, J. I., Seben, D., Sippert, L. R., Salbego, J., . . . Baldisserotto, B. (2018a). Purinergic signaling as potential target of thiamethoxam-induced neurotoxicity using silver catfish (Rhamdia quelen) as experimental model. Molecular and Cellular Biochemistry, 449(1), 39-45.
Baldissera, M. D., Souza, C. F., Seben, D., Sippert, L. R., Salbego, J., Marchesan, E., . . . Golombieski, J. I. (2018b). Gill bioenergetics dysfunction and oxidative damage induced by thiamethoxam exposure as relevant toxicological mechanisms in freshwater silver catfish Rhamdia quelen. Science of the Total Environment, 636, 420-426.
Barbosa, M. O., Moreira, N. F. F., Ribeiro, A. R., Pereira, M. F. R., & Silva, A. M. T. (2016). Occurrence and removal of organic micropollutants: An overview of the watch list of EU Decision 2015/495. Water Research, 94, 257-279.
Bartels, H., Böhmer, M., & Heierli, C. (1972). Serum kreatininbestimmung ohne enteiweissen. Clinica Chimica Acta, 37, 193-197.
doi:https://doi.org/10.1016/0009-8981(72)90432-9
Bass, C., Denholm, I., Williamson, M. S., & Nauen, R. (2015). The global status of insect resistance to neonicotinoid insecticides. Pesticide Biochemistry and Physiology, 121, 78-87.
Béné, C., Macfadyen, G., & Allison, E. H. (2007). Increasing the contribution of smallscale fisheries to poverty alleviation and food security: Food & Agriculture Org.
Bharti, S., & Rasool, F. (2021). Analysis of the biochemical and histopathological impact of a mild dose of commercial malathion on Channa punctatus (Bloch) fish. Toxicology Reports, 8, 443-455.
Boonanuntanasarn, S., Jangprai, A., Kumkhong, S., Plagnes-Juan, E., Veron, V., Burel, C., . . . Panserat, S. (2018). Adaptation of Nile tilapia (Oreochromis niloticus) to different levels of dietary carbohydrates: New insights from a long term nutritional study. Aquaculture, 496, 58-65.
Borges, A., Scotti, L. V., Siqueira, D. R., Zanini, R., Amaral, F. d., Jurinitz, D. F., & Wassermann, G. F. (2007). Changes in hematological and serum biochemical values in jundiá Rhamdia quelen due to sub-lethal toxicity of cypermethrin. Chemosphere, 69(6), 920-926.
Borsuah, J. F., Messer, T. L., Snow, D. D., Comfort, S. D., & Mittelstet, A. R. (2020). Literature Review: Global Neonicotinoid Insecticide Occurrence in Aquatic Environments. Water, 12(12), 3388.
Bose, S., Nath, S., & Sahana, S. (2011). Toxic impact of thiamethoxam on the growth performance and liver protein concentration of a freshwater fish Oreochromis niloticus (Trewavas). Indian journal of fundamental and applied life sciences, 1(4), 274-280.
Bouelet Ntsama, I. S., Tambe, B. A., Tsafack Takadong, J. J., Medoua Nama, G., & Kansci, G. (2018). characteristics of fish farming practices and agrochemicals usage therein in four regions of Cameroon. The Egyptian Journal of Aquatic Research, 44(2), 145-153.
Boyd, C. E. (2017). Chapter 6 - General Relationship Between Water Quality and Aquaculture Performance in Ponds. In G. Jeney (Ed.), Fish Diseases (pp. 147166): Academic Press.
Cai, Y., Yin, Y., Li, Y., Guan, L., Zhang, P., Qin, Y., . . . Li, Y. (2020). Cadmium exposure affects growth performance, energy metabolism, and neuropeptide expression in Carassius auratus gibelio. Fish Physiology and Biochemistry, 46(1), 187-197.
Calitz, C., Hamman, J. H., Fey, S. J., Wrzesinski, K., & Gouws, C. (2018). Recent advances in three-dimensional cell culturing to assess liver function and dysfunction: from a drug biotransformation and toxicity perspective. Toxicology Mechanisms and Methods, 28(5), 369-385.
Campos-Garcia, J., Martinez, D. S. T., Alves, O. L., Leonardo, A. F. G., & Barbieri, E. (2015). Ecotoxicological effects of carbofuran and oxidised multiwalled carbon nanotubes on the freshwater fish Nile tilapia: Nanotubes enhance pesticide ecotoxicity. Ecotoxicology and Environmental Safety, 111, 131-137.
Casida, J. E. (2018). Neonicotinoids and Other Insect Nicotinic Receptor Competitive Modulators: Progress and Prospects. Annual Review of Entomology, 63(1), 125144.
Chagnon, M., Kreutzweiser, D., Mitchell, E. A. D., Morrissey, C. A., Noome, D. A., & Van der Sluijs, J. P. (2015). Risks of large-scale use of systemic insecticides to ecosystem functioning and services. Environmental Science and Pollution Research, 22(1), 119-134.
Chan, C.-B., & Cheng, C. H. K. (2004). Identification and functional characterization of two alternatively spliced growth hormone secretagogue receptor transcripts from the pituitary of black seabream Acanthopagrus schlegeli. Molecular and Cellular Endocrinology, 214(1), 81-95.
Dawood, M. A. O., AbdEl-kader, M. F., Moustafa, E. M., Gewaily, M. S., & Abdo, S. E. (2020). Growth performance and hemato-immunological responses of Nile tilapia (Oreochromis niloticus) exposed to deltamethrin and fed immunobiotics. Environmental Science and Pollution Research, 27(11), 11608-11617.
Desai, B., & Parikh, P. (2013). Biochemical alterations on exposure of imidacloprid and curzate on fresh water fish Oreochromis mossambicus and Labeo rohita. Indian Journal of Forensic Medicine & Toxicology, 7(2), 87.
Ding, T.-t., Zhang, Y.-h., Zhu, Y., Du, S.-l., Zhang, J., Cao, Y., . . . He, L.-s. (2019). Deriving water quality criteria for China for the organophosphorus pesticides dichlorvos and malathion. Environmental Science and Pollution Research, 26(33), 34622-34632.
Doumas B.T., Watson W.A. & Biggs H.G. (1971). Albumin standards and the measurement of serum albumin with bromocresol green. Clin Chim Acta, 31(1):87–96.
Duzguner, V., & Erdogan, S. (2012). chronic exposure to imidacloprid induces inflammation and oxidative stress in the liver & central nervous system of rats. Pesticide Biochemistry and Physiology, 104(1), 58-64.
El Euony, O. I., Elblehi, S. S., Abdel-Latif, H. M., Abdel-Daim, M. M., & El-Sayed, Y. S. (2020). Modulatory role of dietary Thymus vulgaris essential oil and Bacillus subtilis against thiamethoxam-induced hepatorenal damage, oxidative stress, and immunotoxicity in African catfish (Clarias garipenus). Environmental Science and Pollution Research, 27(18), 23108-23128.
El-bouhy, Z. M., Mohamed, F. A. S., Elashhab, M. W. A., & El-Houseiny, W. (2023). Toxicity bioassay and sub-lethal effects of profenofos-based insecticide on behavior, biochemical, hematological, and histopathological responses in Grass carp (Ctenopharyngodon idella). Ecotoxicology, 32(2), 196-210.
El-Garawani, I. M., Khallaf, E. A., Alne-na-ei, A. A., Elgendy, R. G., Mersal, G. A. M., & El-Seedi, H. R. (2021). The role of ascorbic acid combined exposure on Imidacloprid-induced oxidative stress and genotoxicity in Nile tilapia. Scientific Reports, 11(1), 14716.
El-Garawani, I. M., Khallaf, E. A., Alne-na-ei, A. A., Elgendy, R. G., Sobhy, H. M., Khairallah, A., . . . Nofal, A. E. (2022). The Effect of Neonicotinoids Exposure
on Oreochromis niloticus Histopathological Alterations and Genotoxicity. Bulletin of Environmental Contamination and Toxicology, 109(6), 1001-1009.
El-Sayed, A.-F. M. (2020). Chapter 12 - The role of tilapia culture in rural development. In A.-F. M. El-Sayed (Ed.), Tilapia Culture (Second Edition) (pp. 275-295): Academic Press.
El-Sayed, A.-F. M., & Fitzsimmons, K. (2023). from Africa to the world—The journey of Nile tilapia. Reviews in Aquaculture, 15, 6-21.
Ensibi, C., Moreno, D. H., Rodríguez, F. S., Yahya, M. N. D., Míguez-Santiyán, M. P., & Pérez-López, M. (2012). Effects of subchronic exposure to carbofuran on antioxidant defence system and malondialdehyde levels in common carp (Cyprinus carpio L.). Toxicological & Environmental Chemistry, 94(4), 748-759.
Eruola, A., Ufoegbune, G., Awomeso, J., & Abhulimen, S. (2011). Assessment of cadmium, lead and iron in hand dug wells of Ilaro and Aiyetoro, Ogun State, South-Western Nigeria. Research Journal of Chemical Sciences, 1(9), 1-5.
Esenowo, I., Nelson, A., Ekpo, N., Chukwu, M., Akpan, A., Ugwumba, A., . . . Udoidung, N. (2022). Effects of acute exposure to chlorfenapyr on hepatic enzyme activities and serum lipid profile of African catfish, Clarias gariepinus (Burchell 1822). World Journal of Applied Science & Technology, 14(1b), 86-93.
FAO. (2020). The State of World Fisheries and Aquaculture 2020. Sustainability in action. Rome, Italy: FAO.
Fathy, M., Mohamed, I. A., Farghal, A. I. A., Temerak, S. A. H., & Sayed, A. E.-D. H. (2019). Hemotoxic effects of some herbicides on juvenile of Nile tilapia Oreochromis niloticus. Environmental Science and Pollution Research, 26(30), 30857-30865.
Fawcett, J. K., & Scott, J. E. (1960). A rapid and precise method for the determination of urea. J Clin Pathol, 13(2), 156-159. doi:10.1136/jcp.13.2.156
Feidi, I. (2018). Will the new large-scale aquaculture projects make Egypt self-sufficient in fish supplies? Mediterranean Fisheries and Aquaculture Research, 1(1), 31-41.
Finnegan, M. C., Baxter, L. R., Maul, J. D., Hanson, M. L., & Hoekstra, P. F. (2017). Comprehensive characterization of the acute and chronic toxicity of the neonicotinoid insecticide thiamethoxam to a suite of aquatic primary producers, invertebrates, and fish. Environmental Toxicology and Chemistry, 36(10), 28382848.
Fırat, Ö., & Tutus, R. (2020). Comparative Acute Toxicity Assessment of Organophosphate and Avermectin Insecticides on a Freshwater Fish Oreochromis niloticus. Bulletin of Environmental Contamination and Toxicology, 105(4), 582587.
Fırat, Ö., Cogun, H. Y., Yüzereroğlu, T. A., Gök, G., Fırat, Ö., Kargin, F., & Kötemen, Y. (2011). A comparative study on the effects of a pesticide (cypermethrin) and two metals (copper, lead) to serum biochemistry of Nile tilapia, Oreochromis niloticus. Fish Physiology and Biochemistry, 37(3), 657-666.
Fossati, P., & Prencipe, L. (1982). Serum triglycerides determined colorimetrically with an enzyme that produces hydrogen peroxide. Clinical Chemistry, 28(10), 20772080.
Fox, B. K., Breves, J. P., Hirano, T., & Grau, E. G. (2009). Effects of short- and longterm fasting on plasma and stomach ghrelin, and the growth hormone/insulin-like growth factor I axis in the tilapia, Oreochromis mossambicus. Domestic Animal Endocrinology, 37(1), 1-11.
Galappaththi, I. D. L., Dissanayake, R., Welgama, T. W., Somachandara, U. A., Weerarathna, R. S., & Pathirana, G. Y. (2020). Identifying the Empirical Gaps in the Relationships between Student Engagement and Their Academic Achievement: Future Research Perspectives. . South Asian Journal of Social Studies and Economics, 5( 4), 1-8.
Ganeshwade, R. (2012). Effect of dimethoate on the level of cholesterol in freshwater Puntius ticto (Ham). Science Research Reporter, 11(1.0474), 16.1333.
Gardner, D. E., Hayes, A. W., & Thomas, J. A. (2001). New Perspectives: Toxicology and the Environment: Taylor & Francis Group.
Gayashani Sandamalika, W. M., Kwon, H., Lim, C., Yang, H., & Lee, J. (2021). The possible role of catalase in innate immunity and diminution of cellular oxidative stress: Insights into its molecular characteristics, antioxidant activity, DNA protection, and transcriptional regulation in response to immune stimuli in yellowtail clownfish (Amphiprion clarkii). Fish & Shellfish Immunology, 113, 106-117.
Georgieva, E., Stoyanova, S., Velcheva, I., & Yancheva, V. (2014). Histopathological
Alterations in Common Carp (Cyprinus carpio L.) Gills Caused by Thiamethoxam. Brazilian Archives of Biology and Technology, 57.
Ghaffar, A., Hussain, R., Abbas, G., Ali, M. H., Saleem, M., Khan, T., . . . Ahmad, H. (2017). Cumulative Effects of Sodium Arsenate and Diammonium Phosphate on Growth Performance, Hemato-Biochemistry and Protoplasm in Commercial Layer. Pakistan veterinary journal, 37(3).
Ghaffar, A., Hussain, R., Abbas, G., Khan, R., Akram, K., Latif, H., . . . Khan, A. (2021). Assessment of genotoxic and pathologic potentials of fipronil insecticide in Labeo rohita (Hamilton, 1822). Toxin Reviews, 40(4), 1289-1300.
Ghaffar, A., Hussain, R., Noreen, S., Abbas, G., Chodhary, I. R., Khan, A., . . . Niaz, M. (2020). Dose and time-related pathological and genotoxic studies on thiamethoxam in fresh water fish (Labeo rohita) in Pakistan. Pakistan veterinary journal, 40(2), 151-156.
Gibbons, D., Morrissey, C., & Mineau, P. (2015). A review of the direct and indirect effects of neonicotinoids and fipronil on vertebrate wildlife. Environmental Science and Pollution Research, 22(1), 103-118.
Gopal, V., Parvathy, S., & Balasubramanian, P. R. (1997). Effect of Heavy Metals on the Blood Protein Biochemistry of the Fish CYPRINUS CARPIO AND ITS USE AS A BIO-INDICATOR OF POLLUTION STRESS. Environmental Monitoring and Assessment, 48(2), 117-124.
Gornal A.C., Bardawill C.J., David M. M. (1949). Determination of Serum Protein by Means of Biuret Reaction. J. Biol. Chem., 177:751.
Grammer, G. L., Slack, W. T., Peterson, M. S., & Dugo, M. A. (2012). Nile tilapia Oreochromis niloticus (Linnaeus, 1758) establishment in temperate Mississippi, USA: multi-year survival confirmed by otolith ages. Aquatic Invasions, 7(3), 367376.
Green, T., Toghill, A., Lee, R., Waechter, F., Weber, E., Peffer, R., . . . Robinson, M.
(2005). Thiamethoxam Induced Mouse Liver Tumors and Their Relevance to Humans: Part 2: Species Differences in Response. Toxicological Sciences, 86(1), 48-55.
Gröner, F., Ziková, A., & Kloas, W. (2015). Effects of the pharmaceuticals diclofenac and metoprolol on gene expression levels of enzymes of biotransformation, excretion pathways and estrogenicity in primary hepatocytes of Nile tilapia (Oreochromis niloticus). Comparative Biochemistry and Physiology Part C: Toxicology & Pharmacology, 167, 51-57.
Gu, D. E., Luo, D., Xu, M., Ma, G. M., Mu, X. D., Luo, J. R., & Hu, Y. C. (2014). Species diversity defends against the invasion of Nile tilapia (Oreochromis niloticus). Knowl. Managt. Aquatic Ecosyst.(414), 07.
Gu, D., Hu, Y., Wei, H., Zhu, Y., Mu, X., Luo, D., . . . Yang, Y. (2017). Nile Tilapia Oreochromis niloticus (L.). In F. Wan, M. Jiang, & A. Zhan (Eds.), Biological Invasions and Its Management in China: Volume 2 (pp. 77-89). Singapore: Springer Singapore.
Guedegba, N. L., Imorou Toko, I., Ben Ammar, I., François, L., Oreins, N., Palluel, O., . . . Kestemont, P. (2021). chronic effects of a binary insecticide Acer 35 EC on Nile tilapia Oreochromis niloticus through a multi-biomarker approach. Chemosphere, 273, 128530.
Gul, S. T., Khan, A., Farooq, M., Niaz, S., Ahmad, M., Khatoon, A., . . . Hassan, M. F. (2017). Effect of sub lethal doses of thiamethoxam (a pesticide) on hematobiochemical values in cockerels. Pakistan veterinary journal, 37(2), 135-138.
Günal, A. Ç., Erkmen, B., Paçal, E., Arslan, P., Yildirim, Z., & Erkoç, F. (2019). Sublethal Effects of Imidacloprid on Nile Tilapia (Oreochromis niloticus). Water, Air, & Soil Pollution, 231(1), 4.
Hamed, H. S., & Osman, A. G. M. (2017). Modulatory effect of lycopene against carbofuran toxicity in African catfish, Clarias gariepinus. Fish Physiology and Biochemistry, 43(6), 1721-1731.
HASAN, M. M., HASAN, M. M., UDDIN, M. H., SUMON, K. A., AL-AMIN, &
RASHID, H. (2021). Histopathological alterations in the gills of banded gourami (Trichogaster fasciata) exposed to thiamethoxam. Bangladesh Journal of Fisheries, 33(1), 49-56.
Hasan, M. M., Uddin, M. H., Islam, M. J., Biswas, S., Sumon, K. A., Prodhan, M. D. H., & Rashid, H. (2023). Histopathological Alterations in Liver and Kidney Tissues of Banded Gourami (Trichogaster fasciata) Exposed to Thiamethoxam.
Aquaculture Studies, 23(1).
Hassan, H. B., Mohamed, E. A., Abdel Fatah, H., & Mohamed, K. A. (2019). An analytical economic study of fish production in Egypt. Middle East J. Agric. Res, 8(1), 139-152.
Hathout, H. M. R., Sobhy, H. M., Abou-Ghanima, S., & El-Garawani, I. M. (2021). Ameliorative role of ascorbic acid on the oxidative stress and genotoxicity induced by acetamiprid in Nile tilapia (Oreochromis niloticus). Environmental Science and Pollution Research, 28(39), 55089-55101.
Hladik, M. L., Main, A. R., & Goulson, D. (2018). Environmental Risks and Challenges Associated with Neonicotinoid Insecticides. Environmental Science & Technology, 52(6), 3329-3335.
Hoffmann, G. E., Schleicher, E., Weiss, L., & Hoffmann, S. (1982). Comparison of
Two Methods for Very Low Density and Low Density Lipoprotein Cholesterol Determination. 20(6), 457-460. doi:doi:10.1515/cclm.1982.20.6.457
Hossain, M. A., Sutradhar, L., Sarker, T. R., Saha, S., & Iqbal, M. M. (2022). Toxic effects of chlorpyrifos on the growth, hematology, and different organs histopathology of Nile tilapia, Oreochromis niloticus. Saudi Journal of Biological Sciences, 29(7), 103316.
Huang, C., Feng, L., Liu, X.-A., Jiang, W.-D., Wu, P., Liu, Y., . . . Zhou, X.-Q. (2020). The toxic effects and potential mechanisms of deoxynivalenol on the structural integrity of fish gill: Oxidative damage, apoptosis and tight junctions disruption. Toxicon, 174, 32-42.
Huang, D., Li, S., Lu, Y., Sha, M., & Li, J. (2023). Effects of diflubenzuron on shrimp (Neocaridina palmata) in freshwater systems dominated by submerged plant (Ceratophyllum demersum). Chemosphere, 313, 137567.
Hussain, R., Ghaffar, A., Abbas, G., Jabeen, G., Khan, I., Abbas, R. Z., . . . Khan, A. (2022). Thiamethoxam at sublethal concentrations induces histopathological, serum biochemical alterations and DNA damage in fish (Labeo rohita). Toxin Reviews, 41(1), 154-164.
Ihara, M., & Matsuda, K. (2018). Neonicotinoids: molecular mechanisms of action, insights into resistance and impact on pollinators. Current Opinion in Insect Science, 30, 86-92.
Ilahi, I., Waqas, Ullah, S., Ali, H., Begum, R., Nawaz, H., . . . Bibi, S. (2018). Effect of long term exposure to sublethal concentration of imidacloprid on some biochemical and haematological parameters of Grass carp and Goldfish. PAKISTAN JOURNAL OF PHARMACEUTICAL SCIENCES, 31(6), 2655-
2660.
Ismail, H. T., & Mahboub, H. H. (2016). Effect of acute exposure to nonylphenol on biochemical, hormonal, and hematological parameters and muscle tissues residues of Nile tilapia; Oreochromis niloticus. Vet World, 9(6), 616-625.
Jenkins, F., Smith, J., Rajanna, B., Shameem, U., Umadevi, K., Sandhya, V., & Madhavi, R. (2003). Effect of Sub-Lethal Concentrations of Endosulfan on Hematological and Serum Biochemical Parameters in the Carp Cyprinus carpio. Bulletin of Environmental Contamination and Toxicology, 70(5), 0993-0997.
Jeschke, P., Nauen, R., Schindler, M., & Elbert, A. (2011). Overview of the Status and Global Strategy for Neonicotinoids. Journal of Agricultural and Food Chemistry, 59(7), 2897-2908.
Jin, Y., Zhang, X., Shu, L., Chen, L., Sun, L., Qian, H., . . . Fu, Z. (2010). Oxidative stress response and gene expression with atrazine exposure in adult female zebrafish (Danio rerio). Chemosphere, 78(7), 846-852.
Jönsson, E. (2013). The role of ghrelin in energy balance regulation in fish. General and Comparative Endocrinology, 187, 79-85.
Karabay, N. U., & Oguz, M. G. (2005). Cytogenetic and genotoxic effects of the insecticides, imidacloprid and methamidophos. Genetics and Molecular Research, 4(4), 653-662.
Kaya, H., Çelik, E. Ş., Yılmaz, S., Tulgar, A., Akbulut, M., & Demir, N. (2015). Hematological, serum biochemical, and immunological responses in common carp (Cyprinus carpio) exposed to phosalone. Comparative Clinical Pathology, 24(3), 497-507.
Khalil, S. R., Awad, A., & Mohammed, H. H. (2017). Behavioral response and gene expression changes in fipronil-administered male Japanese quail (Coturnix japonica). Environmental Pollution, 223, 51-61.
Khalil, S. R., Elhakim, Y. A., Abd El-fattah, A. H., Ragab Farag, M., Abd ElHameed, N. E., & El-Murr, A. E. (2020). Dual immunological and oxidative responses in Oreochromis niloticus fish exposed to lambda cyhalothrin and concurrently fed with Thyme powder (Thymus vulgaris L.): Stress and immune encoding gene expression. Fish & Shellfish Immunology, 100, 208-218.
Khan, H. A. A., Akram, W., Iqbal, J., & Naeem-Ullah, U. (2015). Thiamethoxam Resistance in the House Fly, Musca domestica L.: Current Status, Resistance selection, Cross-Resistance Potential and Possible Biochemical Mechanisms. PLOS ONE, 10(5), e0125850.
Khan, M. F., Tabassum, S., Sadique, H., Sajid, M., Ghayyur, S., Dil, K., . . . Ullah, I. (2019). Hematological, biochemical and histopathological alterations in common carp during acute toxicity of endosulfan. Int J Agric Biol, 22(4), 703-709.
Kocamaz, D., & Oruc, E. (2018). Assessment of synergistic toxicity two commercial pesticides, thiamethoxam and lambda-cyhalothrin, on total antioxidant/oxidant status, oxidative stress index and somatic indices in different tissues of tilapia. Fresenius Environmental Bulletin, 27(4), 2312-2319.
Kojima, M., Masui, T., Nemoto, K., & Degawa, M. (2004). Lead nitrate-induced development of hypercholesterolemia in rats: sterol-independent gene regulation of hepatic enzymes responsible for cholesterol homeostasis. Toxicology Letters, 154(1), 35-44.
Koracevic, D., Koracevic, G., Djordjevic, V., Andrejevic, S., & Cosic, V. (2001). Method for the measurement of antioxidant activity in human fluids. Journal of clinical pathology, 54(5), 356-361.
Kumar, G., & Engle, C. R. (2016). Technological Advances that Led to Growth of Shrimp, Salmon, and Tilapia Farming. Reviews in Fisheries Science & Aquaculture, 24(2), 136-152.
Kumar, V., Janaiah, C., & Venkateshwarlu, P. (2010). Effect of thiamethoxam alters serum biochemical parameters in Channa punctatus (Bloch). Asian Journal of Bio Science, 5(1), 106-110.
Lal, B., Sarang, M. K., & Kumar, P. (2013). Malathion exposure induces the endocrine disruption and growth retardation in the catfish, Clarias batrachus (Linn.). General and Comparative Endocrinology, 181, 139-145.
Lobson, C., Luong, K., Seburn, D., White, M., Hann, B., Prosser, R. S., . . . Hanson, M. L. (2018). Fate of thiamethoxam in mesocosms and response of the zooplankton community. Science of The Total Environment, 637-638, 1150-1157.
Logaswamy, S., & Remia, K. (2009). Impact of cypermethrin and ekalux on respiratory and some biochemical activities of a freshwater fish, Tilapia mossambica. Current Biotica, 3(1), 65-73.
Mahmoud, H. K., Farag, M. R., Reda, F. M., Alagawany, M., & Abdel-Latif, H. M. R. (2022). Dietary supplementation with Moringa oleifera leaves extract reduces the impacts of sub-lethal fipronil in Nile tilapia, Oreochromis niloticus. Scientific Reports, 12(1), 21748.
Mahmoud, H. K., Reda, F. M., Alagawany, M., & Farag, M. R. (2021). The stress of abamectin toxicity reduced water quality, growth performance, immunity and antioxidant capacity of Oreochromis niloticus fish: Modulatory role of Simmondsia chinensis extract as a dietary supplement. Aquaculture, 534, 736247.
Maienfisch, P., Angst, M., Brandl, F., Fischer, W., Hofer, D., Kayser, H., . . . Widmer, H. (2001). Chemistry and biology of thiamethoxam: a second generation neonicotinoid. Pest Management Science, 57(10), 906-913.
Marlatt, V. L., Leung, T. Y. G., Calbick, S., Metcalfe, C., & Kennedy, C. (2019). Sublethal effects of a neonicotinoid, clothianidin, on wild early life stage sockeye salmon (Oncorhynchus nerka). Aquatic Toxicology, 217, 105335.
Mesnage, R., Biserni, M., Genkova, D., Wesolowski, L., & Antoniou, M. N. (2018). Evaluation of neonicotinoid insecticides for oestrogenic, thyroidogenic and adipogenic activity reveals imidacloprid causes lipid accumulation. Journal of Applied Toxicology, 38(12), 1483-1491.
Midhun, S. J., Neethu, S., Arun, D., Vysakh, A., Divya, L., Radhakrishnan, E. K., & Jyothis, M. (2019). Dietary supplementation of Bacillus licheniformis HGA8B improves growth parameters, enzymatic profile and gene expression of Oreochromis niloticus. Aquaculture, 505, 289-296.
Modesto, K. A., & Martinez, C. B. R. (2010). Roundup® causes oxidative stress in liver and inhibits acetylcholinesterase in muscle and brain of the fish Prochilodus lineatus. Chemosphere, 78(3), 294-299.
Mohamed, I. A., Hamed, M., Abdel-Tawab, H. S., Mansour, S., Soliman, H. A. M., Lee, J.-S., & El-Din H. Sayed, A. (2022). Multi-biomarkers approach to assess the toxicity of novel insecticide (Voliam flexi®) on Clarias gariepinus: from behavior to immunotoxicity. Fish & Shellfish Immunology, 125, 54-64.
Mokhbatly, A.-A. A., Assar, D. H., Ghazy, E. W., Elbialy, Z., Rizk, S. A., Omar, A.
A., . . . Dawood, M. A. O. (2020). The protective role of spirulina and β-glucan in
African catfish (Clarias gariepinus) against chronic toxicity of chlorpyrifos: hemato-biochemistry, histopathology, and oxidative stress traits. Environmental Science and Pollution Research, 27(25), 31636-31651.
Mukherjee, D., Saha, S., Chukwuka, A. V., Ghosh, B., Dhara, K., Saha, N. C., . . . Faggio, C. (2022). Antioxidant enzyme activity and pathophysiological responses in the freshwater walking catfish, Clarias batrachus Linn under sub-chronic and chronic exposures to the neonicotinoid, Thiamethoxam®. Science of The Total Environment, 836, 155716.
Mutlu, E., Aydın, S., & Kutlu, B. (2015). Alterations of growth performance and blood chemistry in nile tilapia (Oreochromis nuoticus) affected by copper sulfate in long-term exposure. Turkish Journal of Fisheries and Aquatic Sciences, 15(3), 481-488.
Mwegoha, W., Kaseva, M., & Sabai, S. (2010). Mathematical modeling of dissolved oxygen in fish ponds. African Journal of Environmental Science and Technology, 4(9), 625-638.
Narra, M. R., Rajender, K., Reddy, R. R., Murty, U. S., & Begum, G. (2017). Insecticides induced stress response and recuperation in fish: Biomarkers in blood and tissues related to oxidative damage. Chemosphere, 168, 350-357.
Nath, S., Bose, S., & Kundu, I. (2012). Effects of Thiamethoxam on Liver Protein of Oreochromis niloticus (Trewavas). Proceedings of the Zoological Society, 65(2), 118-120.
Nishikimi M, Appaji N, Yagi K. (1972). The occurrence of superoxide anion in the reaction of reduced phenazine methosulfate and molecular oxygen. Biochem Biophys Res Commun. 31;46(2):849-54.
Nithyananthan, S., & Thirunavukkarasu, C. (2019). Chemotherapeutic doses of arsenic trioxide delays hepatic regeneration by oxidative stress and hepatocyte apoptosis in partial hepatectomy rat. Toxicology and Applied Pharmacology, 382, 114760.
Nordborg, M., Davis, J., Cederberg, C., & Woodhouse, A. (2017). Freshwater ecotoxicity impacts from pesticide use in animal and vegetable foods produced in Sweden. Science of The Total Environment, 581-582, 448-459.
Oghale, O., Okoboshi, A., Chinedu-Ndukwe, A., Kanu, K., Beka, M., & Avoaja, D. (2021). Effects of Dimethoate Insecticide on Serum Biochemistry of African Catfish (Clarias gariepinus) Juveniles. Journal of Applied Sciences and Environmental Management, 25(6), 977-985.
Ohkawa H., Ohishi W. & Yagi K. (1979): Assay for lipid peroxides in animal tissues by thiobarbituric acid reaction. Anal. Biochem., 95:351-358.
Onada, O., & Ogunola, O. (2017). Effects of catfish brood-stocks Egg combination on hatchability and survival of fish larvae. Journal of Aquaculture Research and Development S, 2, 1-5.
Öner, M., Atli, G., & Canli, M. (2008). Changes in serum biochemical parameters of freshwater fish Oreochromis niloticus following prolonged metal (Ag, Cd, Cr, Cu, Zn) exposures. Environmental Toxicology and Chemistry, 27(2), 360-366.
Osuna-Flores, I., Pérez-Morales, A., Olivos-Ortiz, A., & Álvarez-González, C. A. (2019). Effect of organophosphorus pesticides in juveniles of Litopenaeus vannamei: alteration of glycogen, triglycerides, and proteins. Ecotoxicology, 28(6), 698-706.
PĂUNESCU, A., PONEPAL, C. M., DRĂGHICI, O., & MARINESCU, A. G. (2010). THE ACTION OF SOME INSECTICIDES UPON PHYSIOLOGICAL INDICES
IN RANA (PELOPHYLAX) RIDIBUNDA. Ovidius University Annals of Natural
Sciences, 14(1), 79-82.
Perschbacher, P. W., & Ludwig, G. M. (2004). Effects of diuron and other aerially applied cotton herbicides and defoliants on the plankton communities of aquaculture ponds. Aquaculture, 233(1), 197-203.
Phillips, B. M., Voorhees, J. P., Siegler, K., McCalla, L., Meertens, P., Bower, J., & Tjeerdema, R. S. (2022). Acute and chronic Effects of Clothianidin, Thiamethoxam and Methomyl on Chironomus dilutus. Bulletin of Environmental Contamination and Toxicology, 108(5), 884-889.
Qi, S., Wang, D., Zhu, L., Teng, M., Wang, C., Xue, X., & Wu, L. (2018). Neonicotinoid insecticides imidacloprid, guadipyr, and cycloxaprid induce acute oxidative stress in Daphnia magna. Ecotoxicology and Environmental Safety, 148, 352-358.
Raibeemol, K. P., & Chitra, K. C. (2018). Hematological and biochemical changes in the freshwater fish, Pseudetroplus maculatus exposed to sublethal concentrations of chlorpyrifos. Research & Reviews: A Journal of Life Sciences, 8(3), 108-116.
RANIA, A., & NEDJOUA, E. Z. (2023). GROWTH AND NUTRIENT LEVELS OF A FRESHWATER FISH TREATED WITH NEONICOTINOID PESTICIDE
ADDED TO THE REARING WATER. Water and Environment, 171.
Reitman A. and Frankel S. (1957): A colourimetric method for the determination of serum glutamic oxaloacetate and glutamic pyruvic transaminases. Am. J. Clin. Pathol., 28:56-63.
Remia, K., Logaswamy, S., Logankumar, K., & Rajmohan, D. (2008). Effect of an insecticide (Monocrotophos) on some biochemical constituents of the fish Tilapia mossambica. Poll. Res, 27(3), 523-526.
Rocha, C. P., Cabral, H. N., Marques, J. C., & Gonçalves, A. M. (2022). A global overview of aquaculture food production with a focus on the activity’s development in transitional systems—The case study of a South European Country (Portugal). Journal of Marine Science and Engineering, 10(3), 417.
Sabra, F. S., & Mehana, E.-S. E.-D. (2015). Pesticides toxicity in fish with particular reference to insecticides. Asian Journal of Agriculture and Food Sciences, 3(1).
Salbego, J., Seben, D., Sippert, L. R., Gressler, L. T., Arruda da Cunha, J., Zanella, R., . . . Golombieski, J. I. (2020). Toxicological response of silver catfish (Rhamdia quelen) after acute exposure to a commercial insecticide containing thiamethoxam. Journal of Environmental Science and Health, Part B, 55(8), 749755.
Samanta, M., Swain, B., Basu, M., Panda, P., Mohapatra, G. B., Sahoo, B. R., & Maiti, N. K. (2012). Molecular characterization of toll-like receptor 2 (TLR2), analysis of its inductive expression and associated down-stream signaling molecules following ligands exposure and bacterial infection in the Indian major carp, rohu (Labeo rohita). Fish & Shellfish Immunology, 32(3), 411-425.
Sánchez-Bayo, F., & Goka, K. (2005). Unexpected effects of zinc pyrithione and imidacloprid on Japanese medaka fish (Oryzias latipes). Aquatic Toxicology, 74(4), 285-293.
Sapana Devi, M., & Gupta, A. (2014). Sublethal toxicity of commercial formulations of deltamethrin and permethrin on selected biochemical constituents and enzyme activities in liver and muscle tissues of Anabas testudineus. Pesticide Biochemistry and Physiology, 115, 48-52.
Saqer, B. T., Al-aubadi, I. M., & Ali, A. J. (2019). Study on the effect of imidacloprid in blood, liver and kidney on adult male albino mice. Biochemical & Cellular Archives, 19(2).
Seltenrich, N. (2017). Catching Up with Popular Pesticides: More Human Health Studies
Are Needed on Neonicotinoids. Environmental Health Perspectives, 125(2), A41A42. doi:doi:10.1289/ehp.125-A41
Shaalan, M., El-Mahdy, M., Saleh, M., & El-Matbouli, M. (2018). Aquaculture in Egypt: Insights on the Current Trends and Future Perspectives for Sustainable Development. Reviews in Fisheries Science & Aquaculture, 26(1), 99-110.
Shahjahan, M., Islam, M. J., Hossain, M. T., Mishu, M. A., Hasan, J., & Brown, C. (2022). Blood biomarkers as diagnostic tools: An overview of climate-driven stress responses in fish. Science of The Total Environment, 843, 156910.
Shahjahan, M., Kabir, M. F., Sumon, K. A., Bhowmik, L. R., & Rashid, H. (2017). Toxicity of organophosphorus pesticide sumithion on larval stages of stinging catfish Heteropneustes fossilis. Chinese Journal of Oceanology and Limnology, 35(1), 109-114.
Sharafeldin, K., Abdel-Gawad, H., Ramzy, E., Sweilum, M., & Nagy, M. (2015). Harmful impact of profenofos on the physiological parameters in Nile tilapia, Oreochromis niloticus. International Journal of Basic and Applied Sciences, 4(1), 19-26.
Shehata, G. A. B., & Eldal, N. M. A. (2022). Some Economic Aspects of Fish Food Security in Egypt. Open Journal of Social Sciences, 10(5), 351-366.
Shi, X., Dick, R. A., Ford, K. A., & Casida, J. E. (2009). Enzymes and Inhibitors in Neonicotinoid Insecticide Metabolism. Journal of Agricultural and Food Chemistry, 57(11), 4861-4866.
Soliman, N. F. (2017). Aquaculture in Egypt under changing climate. Alexandria Research Center for Adaptation to Climate Change (ARCA): Alexandria, Egypt.
Stoskopf, M. K. (1993). Fish medicine: W.B. Saunders Co.
Stoyanova, S., Yancheva, V., Iliev, I., Vasileva, T., Bivolarski, V., Velcheva, I., & Georgieva, E. (2016). Biochemical, histological and histochemical changes in Aristichthys nobilis Rich. liver exposed to thiamethoxam. PERIODICUM BIOLOGORUM, 118(1), 29-36.
Sweilum, M. A. (2006). Effect of sublethal toxicity of some pesticides on growth parameters, haematological properties and total production of Nile tilapia (Oreochromis niloticus L.) and water quality of ponds. Aquaculture Research, 37(11), 1079-1089.
Tacon, A. G. J. (2020). Trends in Global Aquaculture and Aquafeed Production: 2000– 2017. Reviews in Fisheries Science & Aquaculture, 28(1), 43-56.
Tacon, A. G. J., & Metian, M. (2013). Fish Matters: Importance of Aquatic Foods in
Human Nutrition and Global Food Supply. Reviews in Fisheries Science, 21(1), 22-38.
Taheri Mirghaed, A., Ghelichpour, M., Mirzargar, S. S., Joshaghani, H., & Ebrahimzadeh Mousavi, H. (2018). Toxic effects of indoxacarb on gill and kidney histopathology and biochemical indicators in common carp (Cyprinus carpio). Aquaculture Research, 49(4), 1616-1627.
Tang, J., Wang, W., Jiang, Y., & Chu, W. (2021). Diazinon exposure produces histological damage, oxidative stress, immune disorders and gut microbiota dysbiosis in crucian carp (Carassius auratus gibelio). Environmental Pollution, 269, 116129.
Temiz, Ö., & Kargın, F. (2023). Responses to the Toxic Effects of the Neonicotinoid Thiamethoxam in Oreochromis niloticus Tissues Using Multiple Biomarkers. Research square.
Temiz, Ö., Kargın, D., & Çoğun, H. Y. (2021). In Vivo Effects on Stress Protein, Genotoxicity, and Oxidative Toxicity Parameters in Oreochromis niloticus Tissues Exposed to Thiamethoxam. Water, Air, & Soil Pollution, 232(6), 221.
Thany, S. H. (2010). Neonicotinoid Insecticides. In S. H. Thany (Ed.), Insect Nicotinic Acetylcholine Receptors (pp. 75-83). New York, NY: Springer New York.
Thompson, D. A., Lehmler, H.-J., Kolpin, D. W., Hladik, M. L., Vargo, J. D., Schilling, K. E., . . . Field, R. W. (2020). A critical review on the potential impacts of neonicotinoid insecticide use: current knowledge of environmental fate, toxicity, and implications for human health. Environmental Science: Processes & Impacts, 22(6), 1315-1346.
Tian, X., Hong, X., Yan, S., Li, X., Wu, H., Lin, A., & Yang, W. (2020). Neonicotinoids caused oxidative stress and DNA damage in juvenile Chinese rare minnows (Gobiocypris rarus). Ecotoxicology and Environmental Safety, 197, 110566.
Tian, X., Yang, W., Wang, D., Zhao, Y., Yao, R., Ma, L., . . . Lin, A. (2018). chronic brain toxicity response of juvenile Chinese rare minnows (Gobiocypris rarus) to the neonicotinoid insecticides imidacloprid and nitenpyram. Chemosphere, 210, 1006-1012.
Tišler, T., Jemec, A., Mozetič, B., & Trebše, P. (2009). Hazard identification of imidacloprid to aquatic environment. Chemosphere, 76(7), 907-914.
Ullah, S., & Zorriehzahra, M. J. (2014). Ecotoxicology: a review of pesticides induced toxicity in fish. Advances in Animal and Veterinary Sciences, 3(1), 40-57.
Ullah, S., & Zorriehzahra, M. J. (2015). Ecotoxicology: a review of pesticides induced toxicity in fish. Advances in Animal and Veterinary Sciences, 3(1), 40-57.
Unniappan, S., & Peter, R. E. (2005). Structure, distribution and physiological functions of ghrelin in fish. Comparative Biochemistry and Physiology Part A: Molecular & Integrative Physiology, 140(4), 396-408.
Valavanidis, A. (2018). Neonicotinoid insecticides. Banned by the European Union in 2018 after scientific studies concluded that harm honey bees. Sci. Rev, 37, 1-20.
Vali, S., Majidiyan, N., Azadikhah, D., Varcheh, M., Tresnakova, N., & Faggio, C. (2022). Effects of Diazinon on the Survival, Blood Parameters, Gills, and Liver of Grass Carp (Ctenopharyngodon idella Valenciennes, 1844; Teleostei: Cyprinidae). Water, 14(9), 1357.
Van den Brink, P. J. (2013). ASSESSING AQUATIC POPULATION AND COMMUNITY-LEVEL RISKS OF PESTICIDES. Environmental Toxicology and
Chemistry, 32(5), 972-973.
Veedu, S. K., Ayyasamy, G., Tamilselvan, H., & Ramesh, M. (2022). Single and joint toxicity assessment of acetamiprid and thiamethoxam neonicotinoids pesticides on biochemical indices and antioxidant enzyme activities of a freshwater fish Catla catla. Comparative Biochemistry and Physiology Part C: Toxicology & Pharmacology, 257, 109336.
Velisek, J., & Stara, A. (2018). Effect of thiacloprid on early life stages of common carp (Cyprinus carpio). Chemosphere, 194, 481-487.
Victoria, S., Hein, M., Harrahy, E., & King-Heiden, T. C. (2022). Potency matters: Impacts of embryonic exposure to nAChR agonists thiamethoxam and nicotine on hatching success, growth, and neurobehavior in larval zebrafish. Journal of Toxicology and Environmental Health, Part A, 85(18), 767-782.
Vieira, C. E. D., Pérez, M. R., Acayaba, R. D. A., Raimundo, C. C. M., & dos Reis Martinez, C. B. (2018). DNA damage and oxidative stress induced by imidacloprid exposure in different tissues of the Neotropical fish Prochilodus lineatus. Chemosphere, 195, 125-134.
Vignet, C., Cappello, T., Fu, Q., Lajoie, K., De Marco, G., Clérandeau, C., . . . Cachot, J. (2019). Imidacloprid induces adverse effects on fish early life stages that are more severe in Japanese medaka (Oryzias latipes) than in zebrafish (Danio rerio). Chemosphere, 225, 470-478.
Walker, H. K., Hall, W. D., & Hurst, J. W. (1990). Clinical methods: the history, physical, and laboratory examinations.
Wang, J., Yin, R., Liu, Y., Wang, B., Wang, N., Xiao, P., . . . Hirai, H. (2023). Metaanalysis of neonicotinoid insecticides in global surface waters. Environmental Science and Pollution Research, 30(1), 1039-1047.
Wang, Y. Y. L., Xiong, J., Ohore, O. E., Cai, Y.-E., Fan, H., Sanganyado, E., . . . Wang, Z. (2022). Deriving freshwater guideline values for neonicotinoid insecticides: Implications for water quality guidelines and ecological risk assessment. Science of The Total Environment, 828, 154569.
Wang, Y., Zhang, Y., Zeng, T., Li, W., Yang, L., & Guo, B. (2019). Accumulation and toxicity of thiamethoxam and its metabolite clothianidin to the gonads of Eremias argus. Science of The Total Environment, 667, 586-593.
Yan, S. H., Wang, J. H., Zhu, L. S., Chen, A. M., & Wang, J. (2016). Thiamethoxam induces oxidative stress and antioxidant response in zebrafish (Danio Rerio) livers. Environmental Toxicology, 31(12), 2006-2015.
Yang, J., Guo, C., Luo, Y., Fan, J., Wang, W., Yin, X., & Xu, J. (2023). Effect of thiamethoxam on the behavioral profile alteration and toxicity of adult zebrafish at environmentally relevant concentrations. Science of The Total Environment, 858, 159883.
Yang, Y., Su, L., Huang, Y., Zhang, X., Li, C., Wang, J., . . . Zhao, Y. H. (2022). Biouptake, tissue distribution and metabolism of a neonicotinoid insecticide clothianidin in zebrafish. Environmental Pollution, 292, 118317.
Yang, Y., Yu, Q., Zhang, C., Wang, X., He, L., Huang, Y., . . . Chen, L. (2023). Acute thiamethoxam exposure induces hepatotoxicity and neurotoxicity in juvenile Chinese mitten crab (Eriocheir sinensis). Ecotoxicology and Environmental Safety, 249, 114399.
Yeates, R. A., Mannik, T., & Calvert, G. D. (1979). The measurement of plasma-HDLcholesterol by precipitation techniques. Pathology, 11(2), 324.
Yousef, M. I., El-Demerdash, F. M., Kamel, K. I., & Al-Salhen, K. S. (2003). Changes in some hematological and biochemical indices of rabbits induced by isoflavones and cypermethrin. Toxicology, 189(3), 223-234.
Yousefi, M., Paktinat, M., Mahmoudi, N., Pérez-Jiménez, A., & Hoseini, S. M. (2016). Serum biochemical and non-specific immune responses of rainbow trout (Oncorhynchus mykiss) to dietary nucleotide and chronic stress. Fish Physiology and Biochemistry, 42(5), 1417-1425.
Yuan, J. S., Reed, A., Chen, F., & Stewart, C. N. (2006). Statistical analysis of real-time PCR data. BMC Bioinformatics, 7(1), 85. doi:10.1186/1471-2105-7-85
Zhang, J., Zhu, M., Wang, Q., & Yang, H. (2023). The Combined Use of Copper Sulfate and Trichlorfon Exerts Stronger Toxicity on the Liver of Zebrafish. International Journal of Molecular Sciences, 24(13), 11203.
Zhang, J.-G., Ma, D.-D., Xiong, Q., Qiu, S.-Q., Huang, G.-Y., Shi, W.-J., & Ying, G.G. (2021). Imidacloprid and thiamethoxam affect synaptic transmission in zebrafish. Ecotoxicology and Environmental Safety, 227, 112917.
Zhang, Y.-M., Xu, W.-B., Lin, C.-Y., Li, B.-Z., & Shu, M.-A. (2023). Selenium alleviates biological toxicity of thiamethoxam (TMX): Bioaccumulation of TMX, organ damage, and antioxidant response of red swamp crayfish (Procambarus clarkii). Journal of Hazardous Materials, 458, 131896.
Zhao, H., Wang, Y., Guo, M., Mu, M., Yu, H., & Xing, M. (2020). Grass carps coexposed to environmentally relevant concentrations of cypermethrin and sulfamethoxazole bear immunodeficiency and are vulnerable to subsequent Aeromonas hydrophila infection. Environmental Pollution, 266, 115156.
Zhong, H., Hu, Y., & Yu, F. (2021). A review on ghrelin and fish reproduction.
Reproduction and Breeding, 1(2), 128-135.
Zhou, Y., Chen, X., Teng, M., Zhang, J., & Wang, C. (2019). Toxicity effects of captan on different life stages of zebrafish (Danio rerio). Environmental Toxicology and Pharmacology, 69, 80-85.
Zhu, L., Li, W., Zha, J., Li, N., & Wang, Z. (2019). chronic thiamethoxam exposure impairs the HPG and HPT axes in adult Chinese rare minnow (Gobiocypris rarus): Docking study, hormone levels, histology, and transcriptional responses. Ecotoxicology and Environmental Safety, 185, 109683.
Zou, Q., Huang, Y., Cao, J., Zhao, H., Wang, G., Li, Y., & Pan, Q. (2017). Effects of four feeding stimulants in high plant-based diets on feed intake, growth performance, serum biochemical parameters, digestive enzyme activities and appetite-related genes expression of juvenile GIFT tilapia (Oreochromis sp.).
Aquaculture Nutrition, 23(5), 1076-1085.
الولخص العربى
تأثير تلىث الوياه بوبيد الثياهيثىكسام على الحالة الصحية لأسواك البلطى النيلي
٠ؼرّّذ أوصش ِٓ ٔظف عىاعىاْ ا ؼاٌاٌؼاٌُ ػػٍٝ الأعّّان وّّظذس سئ١غٟ ثشٌٍٚثشٚذٚذ١ٓ اٌح١ أٛأٟ وّّا٠ ؼرثش الاعرضساع اٌ غّ ىاٌغّىٟ
ِظذس ُِٙ ِٓ ِظادس ذٛٛف١ش اٌ ثشٚٚذ١ٓ ِ١غٛٛس اٌ رىٍٍفح تالإػافح إإٌٝ رٌٌه٠ ٛفش فشص ػّػًّ ٍؼذ٠ذ ِٓ اٌ ٕاط فٟ ظّ ١غ أٔٔحاء اٌ ؼااٌؼاٌُ. ٠ؼرثش اٌ ثٍ طٟ ِٓ أٔ ٛاع الأعّّان اٌٌشائؼح ا رٟ٠ رُ اعرضساػٙٙا فٟ ظّ ١غ أٔٔحاء اٌ ؼااٌؼاٌُ. ففٟ ا ؼاَ 2112، اصد٘٘ش إٔراض ا ث طٟ فٟ ا ؼاٌاٌؼاٌُ ٌ١ظظً إإٌٝ 4.5 ٍِ١ْٛ ؽٓ ِٚٓ اٌ رٛٛلغ أأْ٠ ضداد تشىتشىً وث١ش خلاي ا غ ٛاخ ا مادِح.
أظش٠د زٖ اٌذساعح فٟ ؼِّؼًّ أِِشاع الأعّّان اٌٌراتغ ٌ ؼٙٙذ تحٛٛز ااٌظحح اٌح١ أ ١ح فشع الإعىٕٕذس٠ح -
ِظش خلاي اٌٌفرشج اٌ ّرذج ت١ٓ شٙ شٜ ٠ٌٛ١ٛ ٚأغغطظ ِٓ اٌ ؼاَ 2123 ٌرم١١ُ ذِٜذٜ ذأش١ش ذٍ ٛز اٌاٌّ١اٖ تّث١ذ ا ص١اِ ١ص وغاصٛوغاَ ػػٍٝ ا حاٌٌح اٌٌظح١ح الإٔراظ١ح لأعّّان ا ث طٝ اٌإٌ١ٍٝ ا ّغرضسػح. ػٍٚػٍ١ٗ فمذ ذُ اعرخذاَ ِغرحؼش اوراسا 25% ِٓ إٔٔراض ششوح ع١ عٕرا ِظشٚ اٌ زٜ ٠حرٛحرٜٛ ػػٍٝ 251 ظُ /وعُ ِٓ ا ص١ااِ١ص وغاَ. ٌذساعح ذأش١ش اٌ ّغرحؼش، ذُ ششاء ػذد 211 ِٓ اعّّان اٌ ثٍ طٝ اٌإٌ١ٍٝ تّ رٛٛعؾ ا صاٚصاْ 15 ± 5 ظُ ِٓ إحذٜ ِضاسع الأعّّان ِٓ ِحافظح وفشاٌٌش١خ – ِظش
ٚذُ إٔ ضاٌ ٙا فٟ أحٛٛاع صظاظ١ح عؼح 111 ٌرش تٙٙا ِ١اٖ خاٌ ١ح ِٓ اٌ ىٍ ٛس ٚ ضٚٚدج ترٙترٙٛ٠ح طٕٕاػ١ح .فٝ اٌٌثذا٠ح ذُ ذشت١ح الأعّّان ّذج عثؼح أ٠اَ لثً تذا٠ح اٌٌرعشتح فٝ ِ١اٖ خاٌ ١ح ِٓ اٌ ّغرحؼش ٌ١حذز اٌ رألٍاٌرألٍُ ذُ ذغز٠رٙٙا تأػلاف حث١ث١ح ِٓ إٔٔراض ششوح عى١رش٠ٕط ِظش ،31% تشٚٚذ١ٓ خاَ تّّؼذي 3% ِٓ صٚصْ اٌ غّّىح ِشذ١ٓ٠ ِٛ ً١ا ِغ ذغ١١ش اٌاٌّ١اٖ ظضئ١ا ِشذ١ٓ فٝ الأعثٛٛع تّّغاػذج أ ثٛٛب اٌٌشفؾ لاصاٌٌح اٌٌفؼلاخ ٚتما٠ا اٌ ؼٍف ّا٠ غاػذ ػٍػٍٝ إتماء الاحٛٛاع ٔظ١فح لذس الاِ ىاالاِىاْ ؽٛٛاي فرشج اٌٌرعشتح. تؼذ رٌه، ذُ إػادج ذٛٛص٠غ الأعّّان تشىتشىً ػشٛ ائٟ خّّظ عّ ٛػاخ تىصافح ذظذظً ااٌٝ 11 عّّىاخ ىٌىً حٛٛع ائٝ ٚذُ اعرخذاَ أستؼح ذشو١ضاخ خرٍٍفح ِٓ ِث١ذ اٌٌص١ااِ١ص وغاَ )25 ٍِغٍغ/ ٌرش ٚ51 عٍُِعُ / ٌرش ٚ111 ٍغ / ٌرش ٚ251 ٍِغٍغ/ ٌرش( ت١ ّا ٌُ٠ رُ لإػافح أٜ ِث١ذ عٌٍّّعّٛػحٛػح اٌٌؼاتطح. تؼذ ٙا٠ح اٌٌرعشتح ذُ اخرثاس ذأش١ش ا ر ٛز تّث١ذ ا ص١ااِ١ص وغاَ ػػٍٝ ظٛٛدج اٌاٌّ١اٖ فٝ أحٛٛاع اٌٌرشت١ح وزٌٌه ذأش١شٖ ػػٍٝ إٔراظ١ح أعّان ا ث طٝ ا ّغرضسػح ا حاٌٌح اٌٌظح١ح ٙا.
أظٙٙشخ ا ٕرائط اٌ رؼٍاٌّرؼٍمحٍمح تعٛٛدج اٌاٌّ١اٖ وا شلُ اٌاٌٙ١ذسٚٚظ١ٕٝ غرِٛٚغرٛ٠اخ الأوغع١ٓ اٌ ّزاب ٔغثح ذشثغ الأوغع١ٓ اٌٚاٌٍّٛححٛحح ظٛٛد اخرلافاخ ؼِٕؼٕٛ٠ح راخ دلاٌٌح إحظائ١ح ت١ٓ عّ ٛػاخ اٌٌرعشتح اٌ خرٍٍفح اٌ عّٚاٌّعّٛػحٛػح اٌٌؼاتطح ح١س ععً ألألً اخرلاف ؼِٕؼٕٜٛ تاٌ ٕغثح شلٌٍُشلُ اٌاٌٙ١ذسٚٚظ١ٕٟ ٚالأوغع١ٓ اٌ ّزاب ٔغثح ذشثغ الاوغع١ٓ فٝ اٌ عّ ٛػح اٌ رٝ ذؼشػد رٌٍرٍٛزٛز تّث١ذ ا ص١اِ ١ص وغاَ تّؼذي 251 ٍِغٍغ/ ٌرش أِا تخظٛٛص ٔغثح ٍِٛححٛحح اٌاٌّ١اج فمذ ععٍٍد أػٍأػٍٝ اخرلاف ؼِٕؼٕٜٛ فٝ ااٌىأٔد ػٕٕذ اٌعشػح اٌ ضِ ٕح اٌ ؼاٌ ١ح أػلا٘ٚأػلاُ٘ أ٘أّ٘١ح وأٔد ػٕٕذ اٌٌعشػح اٌ ؼاٌ ١ح ذحد اٌحادج. وّّا وشفد ٔرائط اٌذساعح اٌ رؼٍٍمح تّؼذي ّٔٛ الأعّّان ٚص٠ادج الاٚ صاالاٚصاْ ػػٓ ظٛٛد فشق وث١ش رٚ دلاٌٌح إحظائ١ح فٟ اٌ صاٌٛصْ اٌ ائٟإٌٙائٟ ٚص٠ادج اٌ صاٌٛصْ
عّ ١غ اٌ ؼاِِلاخ تاٌ ماسٔٔح ِغ اٌ عّ ٛػح اٌٌؼاتطح. تالإػافح إٌإٌٝ رٌٌه ، ٛحع ااْ ظٛٛد فشق ؼِٕؼٕٛٞ تغ١ؾ فٟ اٌ صاٌٛصْ اٌ ائٟإٌٙائٟ ٚص٠ادج اٚ صااٚصاْ الاعّّان وأد ػٕٕذ اٌعشػح اٌ ض ٕح ا ؼاٌ ١ح )51 ٍط/ ٌرش( فٟ ح١ٓ ٌُ٠ ىىٓ ٕان ذغ١١ش ؼشِؼٕٜٛ وث١ش ففٝ اٌعشػاخ ذحد اٌحادج .ترحٍ ١ً ػ١ٕاخ اٌٌغ١شَ اٌ عّؼح ِٓ الأعّان ل١ذ اٌٌرعشتح ٌث١ااْ ٔغثح ا ثشٚٚذ١ٓ، ٛحع أٔأٔٗ ٌُ٠ ىىٓ ٕان ذغ١ش ؼِٕؼٕٛٞ ت١ٓ اٌ ؼاِلاخ اٌ خرٍٍفح اٌ عٚاٌّعّٛػحٛػح اٌٌؼاتطح ذش١ش ا ٕرائط إإٌٝ أْ ٔغثح ا ثشٚٚذ١ٓ ذضداد ِغ ص٠ادج ذشو١ض اٌٌص١ااِ١ص وغاَ ماسٔٔح تاٌ ع ٛػح اٌٌؼاتطح. ت١ ّا ف١ ّا٠ خض ٔغثح الأٌٌث١ِٛ١ٓ، ٌُ٠ ىىٓ ٍص١اِ ١ص وغاصٛوغاَ أٞ ذغ١١ش وث١ش ػػٍٝ الاٌٌث١ِٛ١ٓ فٟ اٌ ؼاِِلاخ اٌ خرٍٍفح، وزٌٌه ٌُ٠ ىىٓ ٕان فشق ؼِٕؼٕٜٛ ت١ٓ ع ٛػاخ اٌٌرعشتح ٚت١ٓ اٌ عّ ٛػح اٌٌؼاتطح. أِِا ف١ّا٠ رؼٍك تا عٍ ٛت١ٌٛ١ٓ، ٌُ٠ غثة ا ص١اِ ١صٛ وغاَ فشلًا ِؼٕٕٛ٠ا وث١شًا ت١ٓ اٌّعّّٛػح اٌؼاتطح وً ِٓ اٌ ؼاِِلاخ اٌ ضِ ٕح ٚذحد اٌحادج. فٟ ح١ٓ واواْ ٕان فشق ؼِٕؼٕٛٞ ٚاػح فٟ غرِٛغرٜٛ اٌ عٍ ٛت١ٌٛ١ٓ ت١ٓ ووً ِٓ اٌعشػاخ اٌ ض ٕح ٚذحد اٌحادج ِغ ظٛٛد فشق ؼِٕؼٕٜٛ تغ١ؾ ػٕذ اٌٌرشو١ض ذحد اٌحاد اٌ ٕخفغ. تالاػافح زٌٌه ٌمذ واْ ٕان اسذفاع حٍِحٛظٛظ فٟ غرِٛغرٜٛ ا عٍ ٛت١ٌٛ١ٓ ِغ ص٠ادج ظشػاخ اٌٌص١اِ ١ص وغاَ . أدٜ اٌٌص١اِ ١صٛ وغاَ إٌإٌٝ ظٛٛد فشق ؼِٕؼٕٛٞ فٟ رٛٛعؾ ل١ّح اٌٌىش٠اذ١ٕ١ٓ فٟ اٌٌغ١شَ ت١ٓ اٌعشػح اٌ ضِ ٕح اٌ ؼاٌ ١ح اٌعشػح اٌ ؼاٌ ١ح ذحد اٌحادج ماسٔٔح تاٌ عّ ٛػح اٌٌؼاتطح، تالإػافح إٌإٌٝ أأْ أػٍأػٍٝ ل١ّح ؼِٕؼٕٛ٠ح ف١ّا٠ رؼٍٍك تّ غرٛتّغرٜٛ اٌٌىش٠اذ١ٕ١ٓ ٛحظد ػٕٕذ اٌعشػح اٌ ؼاٌ ١ح ذحد اٌحادج ت١ ّا ألالألالً وأٔد ػٕٕذ اٌٌرشو١ض اٌإٌّخفغٕخفغ ذحد اٌحاد.
1
الولخص العربى
ٌُ ذظٙش ل١ّح رٛٛعؾ اٌ ١ٛس٠ا فٟ اٌ ذَ ظٛٛد فشق ؼِٕؼٕٜٛ ت١ٓ اٌ ع ٛػح اٌٌؼاتطح اٌعشػاخ ذحد اٌحادج فٟ ح١ٓ وأد اػاػٍٝ ا٘اّ٘١ح ؼِٕؼٕٛ٠ح حٍِٛحٛظحٛظح ػٕٕذ اٌعشػح اٌ ضِ ٕح اٌ ؼاٌ ١ح ماسٔٔح تاٌعشػاخ الأخشٜ. ػلاٚٚج ػػٍٝ رٌه، واواْ ٕان اسذفاع ؽف١ف فٟ غرِٛغرٜٛ اٌ ١ٛس٠ا تؼذ 3 أعات١غ ِٓ اٌٌرؼشع ٌٍعشػحٍعشػح اٌ ٕخفؼح اٌ ضِ ٕح) 25 ٍِغٍغ/ ٌرش( واٚواْ أػأػٍٝ ذشو١ض ٌٍ١ٛس٠ا) 24.4 ٍِغٍغ/ د٠غ١ٍرش( ػٕٕذ اٌعشػح اٌ ض ٕح ا ؼاٌ ١ح) 51 ٍغٍِغ/ ٌرش( .ف١ّا٠ رؼٍك تّ غرٛتّغرٜٛ ا عٍ وٛٛص فٟ ا ذَ فٟ اعّ ان ا ث طٟ إٌ١ٍٟ ،إحظائ١اً، ٌُ٠ رُ ا ىشف ػٓ فش ق راخ دلاٌ ح إحظائ١ح ت١ٓ ظّ ١غ اٌّعّّٛػاخ ا ّؼشػح ٌٍّثّث١ذ اٌ ع ٛػحٚاٌّعّٛػح اٌٌؼاتطح. فثؼذ اٌٌرؼشع ٍص١ااِ١ص وغاَصٛوغاَ ّذج 3 أعات١غ، ٛحع أأْ ِغرٜٛ ا عٍ وٛٛص٠ شذفغ ِغ ص٠ادج ظشػح اٌ رغّاٌرغُّ .إػافح اٌاٌٝ رٌه، ٌُ ذظٙش غرٛ ٠اخ ا ىٛاٌىٌٛ١غر١شٚٚي فٟ اٌ ذَ فٟ الأعّان ا ّؼشػح ٍص١اِ ١ص وغاَ أٞ فٛٛاسق راخ دلاٌٌح إحظائ١ح ت١ٓ اٌ عاٌّعّٛػاخٛػاخ ا ّؼشػح ٌٍّثّث١ذ اٌ ع ٛػحٚاٌّعّٛػح اٌٌؼاتطح .تا ٕغثح ٌٍّؤششاخّؤششاخ اٌح١ٛ٠ح لإظٙاد اٌ رأوغذٞ فٟ ا ذَ، أشش ا ص١اِ ١ص وغاَ ع ثًا ػٍٝ اٌّؤششاخ ا ح١ٛ٠ح لإظٙ اد ا رأوغذٞ فٟ ا ث طٟ إٌ١ٍٟ .ِٚغ رٌه، ٌُ ذىذىٓ ٕان فشٚٚق راخ دلاٌٌح إحظائ١ح فٟ غرٛ ٠اخ أٔٔض٠ُ) SOD( ت١ٓ اٌ عّ ٛػاخ اٌ ّؼشػح ٍص١اِ ١ص وغاَ اٌ عّٚاٌّعّٛػحٛػح اٌٌؼاتطح .اِا تا ٕغثح لإٔض٠ُ) MDA(، ٌُ ٠لاحع اٜ فشٚٚق راخ دلاٌٌح إحظائ١ح ت١ٓ اٌ عّ ٛػاخ اٌ ّؼشػح ٌٍّثّث١ذ ىٌٚىٓ واواْ ٕان فشلا ؼِٕؼٕٛ٠ا وث١شا ت١ ٙا ٚت١ٓ اٌ ع ٛػح اٌٌؼاتطح. ػلاٚٚج ػػٍٝ رٌٌه، ٌُ ذىذىٓ ٕ٘انٕان فشٚٚق راخ دلاٌٌح إحظائ١ح فٟ غرٛ ٠اخ اٌٌمذسج اٌ ىٍ ١ح ّؼاداخ الأوغذجTAC) ( ت١ٓ اٌ عّ ٛػح اٌ ّؼشػح ٍص١اِ ١ص وغاَ اٌ عّٚاٌّعّٛػحٛػح اٌٌؼاتطح ت١ ّا وأد ألألً أ٘أّ٘١ح ؼِٕؼٕٛ٠ح حٍِٛحٛظحٛظح ػٕٕذ اٌعشػح اٌ ؼاٌ ١ح ذحد اٌحادج .
ذُ ل١اط ذأش١ش ِث١ذ ا ص١اِ ١ص وغاَ ػػٍٝ اٌٌرؼث١ش اٌع١ٕٟ ٌٍعٍع١ٕاخ اٌ ّشذثطح تاٌتإٌّٛ اٌٚإٌّاػحٕاػح الإظٙٙاد تٛاعطح ذمٕ ١ح
)RT-PCR( ػػٓ ؽش٠ك ل١اط اٌعش٠ٍ١ٓ ٚ TLR2 ٚCAT ففٟ أٔٔغعح ا ىثذ اٌ عّّؼح ِٓ الأعّّان ل١ذ اٌٌرعشتح. ذث١ٓ ظٛٛد اخرلافاخ ؼِٕؼٕٛ٠ح وث١شج فٟ اٌٌرؼث١ش اٌع١ٕٟ ٍصلاز ظ١ٕاخ ت١ٓ ظظّ١غ اٌ عّ ٛػاخ اٌ ّؼشػح ٍص١اِ ١صٛ وغاَ اٌ عّٚاٌّعّٛػحٛػح اٌٌؼاتطح. تالإػافح إإٌٝ رٌه، ٛحع ااْ ألألً أ٘أّ٘١ح ؼِٕؼٕٛ٠ح ف١ّا٠ رؼٍٍك تاٌٌرؼث١ش اٌع١ٕٟ ىٌىً ِٓ اٌعش٠ٍ١ٓ اٌٚاٌىاذلاصٌىاذلاص (CAT) ػٕٕذ اٌعشػح اٌ ؼاٌ ١ح ذحد اٌحادج، فٟ ح١ٓ وأٔد ألألً أ٘أّ٘١ح ؼِٕؼٕٛ٠ح ف١ّا٠ رؼٍٍك تع١ٕاخ اٌ ٕاػح) (TLR2 ػٕٕذ اٌٌعشػح اٌ ضِ ٕح اٌ ٕخفؼح. ػلاٚٚج ػٍػٍٝ رٌٌه، واْ ٕان ص٠ادج وث١شج فٟ اٌٌرؼث١ش اٌع١ٕٟ ٌـ TLR2 فٟ ح١ٓ واواْ ٕان أٔماص فٝ ذٕظ١ُ اٌٌرؼث١ش اٌع١ٕٟ ىٌىً ِٓ اٌعش٠ٍ١ٓ ٚCAT تشىتشىً وث١ش. ح١س وشفد اٌ ٕرائط أأْ رٛٛعؾ ذغ١ش اٌٌط١ح ٍعٌٍع١ٕاخ اٌ ّشذثطح تاٌتإٌّٛ )اٌعش٠ٍ١ٓ( أٔخفغ تض٠ادج ظشػح اٌٌص١اِ ١ص وغاَ . تاٌ ٕغثح ّرثم١اخ اٌٌص١اِ ١ص وغاَ فٟ ٌحٛ َ الأعّان، ذث١ٓ ظٛٛد تما٠ا ّث١ذ اٌٌص١ااِ١ص وغاَ فٟ ػؼلاخ تم١ُ خرٍٍفح ت١ٓ ع ٛػاخ اٌٌرعشتح اٌ ع ٛػحٚاٌّعّٛػح ااٌؼاتطح وأد أػأػٍٝ ٔغثح ػٕذ اٌعشػح اٌ ؼاٌ ١ح ذحد اٌٌحادج )251 ٍغٍِغ/ ٌرش(. اخ١شا، ذُ دساعح ذأش١ش اٌٌص١اِ ١صٛ وغاَ ػٍػٍٝ ِؼذي اٌ فٛٛق فٝ عّ ٛػاخ اٌٌرعشتح ٚذث١ٓ ظٛٛد فشٚٚق ؼِؼٕٛ٠ح فٟ ِؼذي اٌ ٛف١اخ ت١ٓ اٌ عّ ٛػاخ اٌ ّؼشػح ٌٍّثّث١ذ اٌ عّٚاٌّعّٛػحٛػح اٌٌؼاتطح تاعرصٕٕاء ااْ اٌعشػح اٌ ؼاٌ ١ح ذحد اٌحادج )251 ٍِغٍغ/ ٌرش( ٌٚٛحعٛحع أأْ ص٠ادج ِؼذي اٌ ٛف١اخ وأٔد ِشذثطح تض٠ادج ظشػح اٌٌص١اِ ١صٛ وغاَ ت١ ّا ٌُ ٠رُ ذغع١ً أٜ ٚف١اخ فٟ اٌ عّ ٛػح اٌٌؼاتطح أشٕٕاء اٌٌرؼشع ٌٍّثّث١ذ خلاي
ِذج اٌٌرعشتح.
فيوا يلى بعض التىصيات التى يوكن وضعها فى الاعتبار بناء على النتائج التى تن التىصل إليها فى الدراسة الحالية:
1. ٠عة الا٘ ر اَ تا رحٍ ١ً ا ذٚ سٞ ٌؼ١ٕاخ اٌاٌّ١اٖ ِٓ ا ّغطحاخ اٌ ّائ١ح لاورشاف تما٠ا ا ّث١ذاخ اٌحشش٠ح تاعرخذاَ ذمذمٕ١ح) HPLC( ٌرعٕة طٛٛي اٌاٌّ١اٖ اٌٛشحاٌٍّٛشح إإٌٝ أحٛاع الاعرضساع ا غ ىٝ ّا لذ٠ رغثة فٝ حذٚز فٛٛق ظّ اػظّاػٟ لأعّان.
2. اٌ رٕٕث١ٗ ػػٍٝ أطحاب ا ّضاسع اٌ غّى١ح ترعٕٕة اعرخذاَ ِ١اٖ اٌٌظشف ا ضساػٟ فٟ ذشت١ح الأعّّان لثلثً ؼاٌعح زٖ اٌاٌّ١اٖ رخٌٍرخٍضٍض ِٓ ِرثم١اخ اٌ ّث١ذاخ اٌحشش٠ح صِصً اٌٌص١اِ ١ص وغاَ .
3. اٌ رخٍض تشىتشىً طحٟ ِٓ ِ١اٖ اٌٌظشف اٌ ظحٟ اٌ خٍٚاٌّخٍفاخٍفاخ اٌ ٕاذعح ػػٓ اٌ ظأاٌّظأغٔغ تؼ١ذا ػػٓ اٌ ّغطحاخ اٌ ّائ١ح.
2
______________________________________________
كليــــح الطــة الثيطــــــرى قسن صحح الحيواى والأهراض الوشرركح
ذأثير ذلوز الوياٍ توثيد الثياهيثوكسام علي الحالح الصحيح لأسواك الثلطي الٌيلي
رسالـــح علويــــح هقدهـــح إلي الدراساخ العليا
كليح الطة الثيطـــــــرى – جاهعح الاسكٌٌدريـــــــــــــــــــــح اسريفاء للدراساخ العليا الوقررج للحصول علي درجح الواجسريــــر في العلــــــوم الطثيــــــــح الثيطريــــــــــــح
تخصص
صحح الحيواى
هقدهح هي
ط. ب/. الشيواء السيد ًصحي اتراهين
تكالريوس العلـــــوم الطثيـــــح الثيطريــــــح 0202
كليح الطة الثيطرى ـ جاهعح الأسكٌدريح
0204
ذحد إشــــــــــراف
أ.د /.محمد السيد عثد اللطيف ًصير
أستاذ ورئيس قسم صحة الحيىان والأمراض المشتركة
كلية الطب البيطري – جامعة الأسكندرية
د/ علاء محمد السيد هٌٌصور
مدرس صحة الحيىان
قسم صحة الحيىان والأمراض المشتركة كلية الطب البيطري – جامعة الأسكندرية
د/ رحاب علي عثد العزيز السيد
باحج أول بقسم أمراض الأسماك – معهد بحىث الصحة الحيىانية
الأسكندرية
ـــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــ
Faculty of Veterinary Medicine
Department of Animal Hygiene and Zoonoses
Impact of Thiamethoxam polluted water on health condition of Nile Tilapia
A thesis submitted in partial fulfillment of the requirements for the degree of master of Veterinary Sciences
Specialty
Animal Hygiene
Presented by
El-Shaymaa El Sayed Noshi Ibrahim
(B. V. Sc. Faculty of Veterinary Medicine, Alexandria University, 2020)
(2024)
Advisors’ committee
Prof. Dr. Mohammad Al Sayed Nossair
Professor and Head of Department of Animal Hygiene and Zoonoses Faculty of Veterinary Medicine, Alexandria University.
Dr. Alaa Mohammad Al Sayed Mansour
Lecturer of Animal Hygiene
Department of Animal Hygiene and Zoonoses
Faculty of Veterinary Medicine, Alexandria University
Dr. Rehab Ali Abd- Elaziz El Sayed
Fish Diseases Department, Alexandria Provincial Lab, Animal Health
Research Institute (AHRI), Agricultural Research Center (ARC), Egypt
Acknowledgment
Firstly, many great thanks to our merciful ALLAH who always beside me and gave me the ability to finish this work.
I would like to express my sincere gratitude to Prof. Dr. Mohammad Al- Sayed Nossair; Professor of Zoonoses, Head of Animal Hygiene and Zoonoses Department, Faculty of Veterinary Medicine, Alexandria University; for his relentless support and golden advice that enabled me to tackle many hardships during this work. His motivation and assistance inspired me deeply and showed me that work alone is meaningless without passion and zealot. His scientific expertise and kind soul will always enlighten my scientific path.
Undoubtedly, I cannot forget to express my deepest appreciation to my supervisor Dr. Alaa Mohammad Mansour Lecturer of Animal Hygiene, Faculty of Veterinary Medicine, Alexandria University for his continuous help and support that enlightened me a lot during performing this work. His insightful remarks and constant assistance throughout all phases of this work have remarkably contributed to this work accomplishment. I am thankful for her patience and her pursuit to improve my work quality.
Also, my great appreciation goes to Dr. Rehab Ali Abd- Elaziz El Sayed Fish Diseases Department, Alexandria Provincial Lab, Animal Health Research Institute (AHRI), Agricultural Research Center (ARC), Egypt for her valuable advices, fruitful suggestions and continuous encouragement as well as her generous efforts in the evaluation of this work and I am always indebted for everything she offered for the completion of this work with improved quality.
I would like to express my sincere gratitude to Nourhan El Banhawy; Assistant lecturer, Department of Animal Husbandry and Animal Wealth Development, Faculty of Veterinary Medicine, Alexandria University for performing statistical analysis during my work.
Also, my great appreciation goes to Fish Diseases Department, Alexandria Provincial Lab, Animal Health Research Institute (AHRI), Agricultural Research Center (ARC), Egypt for technical support.
It is great pleasure to record all meaning of indebtedness to all staff members of Animal Hygiene and Zoonoses Department, Faculty of Veterinary Medicine, Alexandria University.
Contents
Page
1. Introduction. 1
2. Review of literatures. 4
3. Material and Methods. 23
4. Results. 30
5. Discussion. 74
6. Summary. 89
7. Conclusion and recommendations. 93
8. References. 95
9. Arabic summary
List of Tables
Table Title Page
I Description of experimental fish groups to evaluate effects of thiamethoxam 24
II Determination of serum biochemical indices 25
III Oligonucleotide primers and probes used in SYBR Green real time PCR 26
1 Mean values of some parameters regarding water quality after using different levels of thiamethoxam insecticide 30
2 Effect of thiamethoxam insecticide on growth rate of Nile tilapia 32
3 Biochemical parameter among different levels of thiamethoxam in Nile tilapia 34
4 Oxidative stress parameters among different levels of thiamethoxam in Nile tilapia 48
5 Impact of thiamethoxam insecticide on growth related,
immunity and stress genes expression in liver of Nile tilapia 63
6 ∆CT and ∆∆CT of ghrelin gene 65
7 ∆CT and ∆∆CT of TLR2 gene 66
8 ∆CT and ∆∆CT of CAT gene 67
9 Thiamethoxam residue in Nile tilapia muscles reared under
different levels 70
10 Impact of thiamethoxam insecticide on survival of Nile tilapia 72
List of Figures
Fig. Title Page
1 Mean values of some parameters regarding water quality after using different levels of thiamethoxam insecticide 31
2 Effect of thiamethoxam on growth rate of Nile tilapia 33
3 Effect of thiamethoxam on serum protein in Nile tilapia 35
4 Effect of thiamethoxam on albumin level in Nile tilapia 36
5 Effect of thiamethoxam on serum globulin in Nile tilapia 37
6 Effect of thiamethoxam on creatinine level in Nile tilapia 38
7 Effect of thiamethoxam on urea level in Nile tilapia 39
8 Effect of thiamethoxam on glucose level of Nile tilapia 40
9 Effect of thiamethoxam on ALT level in Nile tilapia 41
10 Effect of thiamethoxam on AST level in Nile tilapia 42
11 Effect of thiamethoxam on cholesterol level in Nile tilapia 43
12 Effect of thiamethoxam on TAG level on Nile tilapia 44
13 Effect of thiamethoxam on VLDL levels in Nile tilapia 45
14 Effect of thiamethoxam on HDL level in Nile tilapia 46
15 Effect of thiamethoxam on LDL level in Nile tilapia 47
16 Effect of thiamethoxam on oxidative stress parameters in Nile tilapia 49
17 Impact of thiamethoxam on growth related, immunity and stress genes expression in liver of Nile tilapia 68
18 Plot amplification for ghrelin gene 68
19 Plot amplification for TLR2 gene 69
20 Plot amplification for CAT gene 69
21 Thiamethoxam residues in Nile tilapia muscles reared under different levels of poisoning 71
22 Impact of thiamethoxam on survival of Nile tilapia 73
List of photos
Photo Title Page
1 Gill of Nile Tilapia fish of the Control group showing normal primary and secondary gill lamellae 50
2 Gill of Nile Tilapia fish of T2 group (Thiamethoxam 25 mg/l /21 days) showing lamellar lifting and congestion of branchial blood vessel 51
3 Gill of Nile Tilapia fish of T2 group (Thiamethoxam 25 mg/l /21 days) showing filamentous clubbing 51
4 Gill arch of Nile Tilapia fish of T2 group (Thiamethoxam 25 mg/l /21 days) showing eosinophilic granular cells (EGCs) infiltration and congestion of blood vessel 52
5 Gill of Nile Tilapia fish of T3 group (Thiamethoxam 50 mg/l /21 days) showing lamellar telangiectasis 52
6 Gill of Nile Tilapia fish of T3 group (Thiamethoxam 50 mg/l /21 days) showing unilateral fusion of secondary lamellae 53
7 Gill arch of Nile Tilapia fish of T3 group (Thiamethoxam 50 mg/l /21 days) showing hemorrhage 53
8 Gill of Nile Tilapia fish of T4 group (Thiamethoxam 100 mg/l /4 days) showing curved secondary lamellae 54
9 Gill of Nile Tilapia fish of T4 group (Thiamethoxam 100 mg/l /4 days) showing lamellar lifting 54
10 Gill arch of Nile Tilapia fish of T4 group (Thiamethoxam 100 mg/l /4 days) showing eosinophilic granular cells and congestion of blood vessel 55
11 Gill of Nile Tilapia fish of T5 group (Thiamethoxam 250 mg/l /4 days) showing unilateral fusion of secondary lamellae 55
12 Gill of Nile Tilapia fish of T5 group (Thiamethoxam 250 mg/l /4 days) showing lamellar lifting due to edematous separation of lamellar epithelium from capillary beds 56
13 Gill arch of Nile Tilapia fish of T5 group (Thiamethoxam 250 mg/l /4 days) showing eosinophilic granular cells 56
14 Hepatopancreas of Nile Tilapia fish of control group showing normal hepatocytes 57
15 Hepatopancreas of Nile Tilapia fish of T2 group (Thiamethoxam
25 mg/l /21 days) showing congestion of central veins 57
16 Hepatopancreas of Nile Tilapia fish of T2 group (Thiamethoxam 25 mg/l /21 days) showing diffuse hydropic degeneration of hepatocytes 58
17 Hepatopancreas of Nile Tilapia fish of T2 group (Thiamethoxam 25 mg/l /21 days) showing activation in melanomacrophage centers (MMCs) 58
18 Hepatopancreas of Nile Tilapia fish of T3 group (Thiamethoxam
50 mg/l /21 days) showing congestion of central veins 59
19 Hepatopancreas of Nile Tilapia fish of T3 group (Thiamethoxam 50 mg/l /21 days) showing sharp edge outline vacuoles of hepatocytes 59
20 Hepatopancreas of Nile Tilapia fish of T3 group (Thiamethoxam
50 mg/l /21 days) showing activation in MMCs 60
21 Hepatopancreas of Nile Tilapia fish of T4 group (Thiamethoxam 100 mg/l /4 days) showing congestion of central veins and eosinophilic granular cells 60
22 Hepatopancreas of Nile Tilapia fish of T4 group (Thiamethoxam 100 mg/l /4 days) showing destruction and necrosis of pancreatic acini 61
23 Hepatopancreas of Nile Tilapia fish of T5 group (Thiamethoxam 250 mg/l /4 days) showing activation in MMCs and congestion of blood vessel 61
24 Hepatopancreas of Nile Tilapia fish of T5 group (Thiamethoxam 250 mg/l /4 days) showing sharp edge outline vacuoles of hepatocytes 62
List of abbreviations
Abbreviations Full words
A/G ratio Albumin/globulin ratio
AAN Amino acid nitrogen
ABM Abamectin
Ach Acetylcholine
ALAT Alanine aminotransferase
ALP Alkaline phosphatase
ALT Alanine transaminase
ANOVA Analysis of Variance
ASAT Aspartate aminotransferase
AST Aspartate transaminase
BUN Blood urea nitrogen
bw Body weight
CAT Catalase
Cd Cadmium
CLO Clothiandin
CPF Chlorpyrifos
CT Cycle threshold
CYP Cypermethrin
dl deciliter
DM Deltamethrin
DO Dissolved oxygen
DO% Oxygen saturation percentage
EGCs Eosinophilic granular cells
FINAS Finasterides
g Gram
GDH Glutamate dehydrogenase
GH Growth hormone
GPx Glutathione peroxidase
GST Glutathione s-transferase
HDL High density lipoproteins
HPG axis Hypothalamic pituitary gonadal axis
HSI Hepatosomatic index
IL Interleukin
IMI Imidacloprid
IMID Imidacloprid
INF Intrinsic factor binding antibody test
ISO/IEC International Organization For Standardization /International
Electrotechnical Commission
IU International unit
Kg Kilo gram
L Liter
LCH Lamada Cyhalothrin
LDL Low density lipoproteins
LPO Lipid peroxidation
LTA Lipotechoic acid
MCP Monocrotophos
MDA Malondialdehyde
MMCs Melanomacrophage centers
mg Milligram
mM millimeter
nAChR Nicotinic acetylcholine receptors
NEFA Non esterified fatty acids
NENI Neonicotinoid insecticide
NEO Neonicotinoid
NIC Nicotine
NPN Non protein nitrogen
OXI Oxidative stress index
PGN peptidoglycan
PH Potential hydrogen
ppm Part per million
ROS Reactive oxygen species
RT-PCR Real time polymerase chain reaction
SA Serum albumin
SAS Statistical Analysis System
SD Standard Deviation
SG Serum globulin
SGR Specific growth rates
SOD Super oxide dismutase
TAC Total antioxidant capacity
TAG Triacylglycerol
TDN Total digestible nutrients
TDS Total dissolved solids
TGs Triglycerides
THX Thiamethoxam
TLR2 Toll like receptor 2
TLRs Toll like receptors
TMX Thiamethoxam
TOS Total oxidant status
U Unit
USEPA US Environmental protection agency
VLDL Very low density lipoproteins
wt Weight
μg Microgram
1. Introduction
While water is covering more than 70% of the planet and about 30% of mankind suffering from malnutrition, aquatic foods are considered a vital part of the world food storage that may improve all people’s general health, nutrition, and well-being (Tacon and Metian, 2013). Besides, as a healthy food, fish such as finfish, crustaceans and molluscs, represents an important part of human nutrition, accounting for at least 20% of protein consumed by a third of population in the world, with the maximum dependence observed at developing countries (Béné et al., 2007).
However, the Nile tilapia Oreochromis niloticus (L.) is found to be among fish species that are mostly cultured around the world, besides it is considered among of the most widespread invasive fish species in the world (Gu et al., 2017). Additionally, species of Tilapia are preferred in fish farming as they can reproduce quickly after birth, have flexible life requirements, are resistant to a variety of environmental circumstances, and develop quickly (Grammer et al., 2012; Gu et al., 2014).
Obviously, frequently pesticides are used in agriculture sector around the world to increase the output of the crops with little use of labor and efforts (Ullah and Zorriehzahra, 2015), in spite of this, they are able to persist in the ecosystem throughout time (Nordborg et al., 2017). Moreover, numerous pollutants of the environment mainly pesticides and heavy metals have been related to negative impact including abnormalities in spermatogenesis, inadequate fertilization, apoptosis, DNA fragmentation and mitochondrial dysfunctions in humans and other organisms as a result of ROS-scavenging antioxidants inhibition (Khan et al., 2015; Ghaffar et al., 2017).
Additionally, exposure to pesticides can cause adverse impacts in a variety of nontargeted creatures with fish being one of the most notable among them (Ullah and Zorriehzahra, 2015). Unfortunately, fish are susceptible to water pollutants among all aquatic vertebrates. Furthermore, different toxicants can cause physiological and biochemical alterations in the fish as they are up taken through the skin, gills or gastrointestinal tract particularly and distribute into various fish tissues (Ghaffar et al., 2021).
For Campos-Garcia et al. (2015), areas used for fish and other aquatic organisms farming are frequently subjected to water polluted by agrochemicals as these areas are close to fields where vegetables are grown and treated with these chemicals. In addition, as a result of the wide application of these chemicals, they are able to reach surface waters through spray drift or surface runoff (Ding et al., 2019).
In 1980s, Neonicotinoids were regarded as the only significant novel class of insecticides that were used to control large number of pest populations, besides, they are the most recently developed insecticides class to be improved (Stoyanova et al., 2016). Moreover, somewhat neonicotinoids are soluble in water (e.g. Thiamethoxam 4.1 g/L) and they can leech into close water bodies (Tišler et al., 2009).
Second-generation of neonicotinoids as clothianidin (CLO) and thiamethoxam (THM) were introduced by Sumitomo Chemical/Bayer and Syngenta, respectively, in the early 2000s (Jeschke et al., 2011). Recent evidences suggested that throughout the world, thiamethoxam is regarded as the most frequently used neonicotinoid insecticide. In fact, extensive use of thiamethoxam has led to detection of its residues in water, causing an adverse latent impact on the aquatic creatures’ life (Zhou et al., 2019).
Thiamethoxam (THX) is a commonly used neonicotinoid insecticide in agriculture in order to manage a wide range of sucking and chewing pest insects (Finnegan et al., 2017). To control pests, thiamethoxam interferes with neurotransmission by acting on the receptors of nicotinic acetylcholine (ACh) in the central nervous system of the insects (Zhang et al., 2021). Obviously, Clothianidin which is produced from thiamethoxam inside organisms is more active than the original molecules (Shi et al., 2009). Furthermore, because of the little differences in chemical structure of thiamethoxam from other members of neonicotinoid insecticides, it is considered as the most water soluble of this family (PĂUNESCU et al., 2010).
The insecticide Actara 25 WG that has an active ingredient (thiamethoxam 25%) was approved for use on seeds, leaf surfaces and the ground to prevent a variety of pests, such as aphids, white butterflies, cuttlefish and some cockroaches species (Maienfisch et al., 2001). Surface runoff, groundwater leaching and spray-drift are the ways by which thiamethoxam can reach aquatic environments leading to negative impacts on the aquatic life, involving fish (Valavanidis, 2018).
Generally, neonicotinoids intoxication results in mutagenic and carcinogenic changes (Karabay and Oguz, 2005). Moreover, it was stated that THM leads to immunotoxicity, oxidative stress, hepatorenal damage, hemato-biochemical changes and metabolic abnormalities mainly in fish (Salbego et al., 2020).
Various indices including reproduction, growth and survival of aquatic organisms are also adversely affected. Similarly, Hussain et al. (2022) found that fresh water fish subjected to sublethal concentrations of thiamethoxam experienced alterations in serum biochemistry, DNA damage histopathological changes. In addition, it was reported that toxic impacts induced by pesticides on fish occur through elevating the reactive oxygen species (ROS) levels (Temiz et al., 2021).
As well, it was reported that reproductive capacity of fish is adversely affected by pesticides leading to sexual developmental abnormalities, male feminization, changes in sex ratio, and abnormal mating behavior (Jenkins et al., 2003). Furthermore, synaptic transmission disruption in the nervous system of fish results inneurological disorders and systemic neurotoxicity (Hladik et al., 2018).
There was a dramatic increased damage of the DNA in liver, kidneys, and blood cells detected by comet assay in Labeo rohita (Hussain et al., 2022). Undoubtedly, marked changes in fish hemato-biochemical indices, histopathology, and immune profile serve as vital biomarkers in toxicological investigations mainly in pesticides toxicity (Vali et al., 2022).
Although thiamethoxam toxic impacts have been studied in several researches but we know little about its impact on Nile Tilapia specially, so exclusively, this study aimed to estimate the adverse effects of water polluted by thiamethoxam insecticide on Nile tilapia health condition through of the following:
1. Evaluation of some water quality parameters.
2. Evaluation of productive performance of fish.
3. Evaluation of some biochemical indices in serum including;
• Total protein, albumin and globulin • Glucose and cholesterol levels.
• Liver and kidney functions.
• Oxidative stress biomarkers including superoxide dismutase, malondialdehyde and total antioxidant capacity activities.
4. Detection of histopathological alliterations that have occurred in liver and gills of fish.
5. Application of Real time PCR technique for detection of growth related, stress and immunity genes in liver tissues of fish.
6. Determination of pesticide residues concentration inside fish flesh.
7. Determination of Fish mortalities.
2. Review of literatures
2.1. Fish farming:
2.1.1. Value and importance of fish farming:
Onada and Ogunola (2017) mentioned that fish farming around the world has developed significantly to be economically an important business in last 20 years. In comparison with all animal food producing industries, aquaculture keeps growing with an average world yearly growth level of 8.8 percent every year.
Bouelet Ntsama et al. (2018) stated that fish has long played a main role in the diets of people in different areas of the world. For the majority of the economically disadvantaged socioeconomic strata, fish provides people with minerals, vitamins, proteins and unsaturated essential fatty acids.
Galappaththi et al. (2020) cleared that the industry that produces the most food at the quickest rate of growth is fish aquaculture, which makes over 50% of all fish produced worldwide. Globally, 424 aquatic species are cultivated, which benefits millions of people by reducing poverty and promoting food security, nutrition, and sustainable livelihoods.
Tacon (2020) mentioned that there were 53.4 million tonnes of fish recorded in 2017, with a value about US$ 139.7 billion. Since 2000, fish output has increased at an average yearly rate of 5.7% annually. Fish production has been reported from over 208 distinct species. Furthermore, whereas freshwater fish species accounted for over 83.6% of fish produced, compared to just 13.4% from capture fisheries, our world is covered with over 70% marine or brackish water.
FAO (2020) reported that aquaculture encompassed the cultivation of a variety of aquatic plants and animals; however it is always associated with fish farming. Among the species frequently selected for aquaculture are fish, mollusks, crabs, seaweed, and others. Aquatic species including fish are cultivated in both freshwater and marine environments.
Rocha et al. (2022) assumed that global production has grown from 0.6 million metric tons in 1950 to 120 million metric tons in 2019.
2.1.2. Aquaculture industry in Egypt:
Soliman (2017) pointed out that Egypt’s aquaculture industry, which is the hugest in Africa, recently is regarded as the main fish provider, with overall amount of output about 1.8 million tons. With regard to this, aquaculture of fish has grown quickly from 0.54 million tons in 2005 to 1.23 million tons in 2015 because of rapid development of new technologies applied such as the use of extruded feed, water circulation systems, and enhanced farm management practices.
Feidi (2018) mentioned that Egypt is the greatest producer of aquaculture in Africa, making up 73.8 percent of the continent’s total aquaculture volume and 64.2 percent of its total aquaculture value. Egypt is ranked also as world’s seventh-biggest producer. A total of 1.5 million tonnes in 2015 was Egypt’s total fisheries output from all sources (marine, freshwater, and aquaculture), from which 1.2 million tonnes came from aquaculture (78%) and 336,000 tonnes from capturing as inland and marine fisheries (22%).
Shaalan et al. (2018) supposed that, Egypt has practiced aquaculture for thousands of years, but only recently new approaches have been adopted to increase its output. Today, the hugest aquaculture production in Africa is Egypt, with nearly one million tonnes annually.
Hassan et al. (2019) clarified that fish farming is a useful provider of high-quality protein. The value of fish produced in 2016 was LE 20 billion, or almost 9.5% of the overall agricultural revenue of 209.9 billion pounds. Egypt’s fish culturing is the primary source of fish production, making nearly 73.3% of the country’s total fish output in 2016. Fish from all other natural water sources, such as lakes, seas, and the Nile River with its branches, accounted for around 391.8 thousand tonnes, or 26.7% of the total fish output.
Shehata and Eldal (2022) mentioned that fisheries have seen an impressive growth in the use of fish as a protein source compared to other animal protein sources, particularly for low-income populations. from 2001 to 2018, the consumption of the average per capita has increased from approximately 15.8 kg/year in 2001 to approximately 21 kg/year in 2018, representing a rate of increase approximately 32.9%. The growth rate per year reached around 5.4%.
2.1.3. Significance of cultivation of Nile tilapia:
Kumar and Engle (2016) stated that Nile tilapia that lives in warm water is among the most significant fishes used in aquaculture.
Boonanuntanasarn et al. (2018) clarified that various systems for culturing can be attributed for farming tilapia, as Nile tilapia are characterized by fast-growth, the ability of adaptation in various environmental conditions, capability of small ponds reproduction and artificial feed consumption from the primary feeding stage ability.
El-Sayed (2020) showed that, Nile tilapia, usually represented as the ‘aquatic chicken’, can be considered as an economic fish when compared to other cultured fish, which consume higher trophic levels. So, in many times, it is considered as a food for low income individuals, or the fish for the masses.
FAO (2020) reported that the third main cultivated fish species in the world was the Nile tilapia, exceeding Cyprinus carpio production, the common carp and this growth in production ended in a steady rise in the rate of per capita of tilapia consumption in recent years.
El-Sayed and Fitzsimmons (2023) clarified that farming Nile tilapia is leaded in Africa by Egypt in 2019, which made 84% to Nile tilapia farming output in Africa. Also, they added that Egypt is considered the third one in the top producers of Nile tilapia in the world, after China and Indonesia.
2.2. Pesticides:
Pesticides contaminated surface waters is known to have negative impacts on the reproduction, survival and growth of aquatic animals. Different concentrations of insecticides are found in various types of waste water and numerous studies have found them to be toxic to aquatic organisms, particularly fish species (Sabra & Mehana, 2015).
2.2.1. Chemical classification and mode of action:
Thiamethoxam [3-(2-chloro-1, 3-thiazol-5-methyl) −5–methyl -4nitroimino - perhydro-1, 3, 5-oxadiazine] is classified as a neonicotinoid insecticide of second generation one, which act against a wide variety of commercially important pests whether they are sucking or chewing (Green et al., 2005 and Thany, 2010).
In comparison with other neonicotinoids, Van Dijk et al. (2013) reported that thiamethoxam was the most efficient pesticide as it had a unique ability of binding irreversibly with post synaptic nAChR.
Bass et al. (2015) mentioned that the global thiamethoxam sales in 2012 reached US $1.1 billion, which represented about 37.6 % of the overall neonicotinoid insecticides market share.
Albinati et al. (2016) mentioned that the insecticide thiamethoxam, which is a second generation neonicotinoid, belongs to toxicological classification III (medium toxicity) and environmental class III (environmentally dangerous).
Gul et al. (2017) pointed out that thiamethoxam, which is applied extensively in agriculture sector for controlling leafhoppers, whiteflies, and aphids, is a thianicotinyl subclass of neonicotinoid (NEO) insecticides.
Ihara and Matsuda (2018) mentioned that neonicotinoid insecticides (NENIs) including imidacloprid, thiamethoxam and clothiandin are commonly used in agricultural and urban places.
Moreover, neonicotinoids are mimics of acetylcholine, they are agonists for nicotinic acetylcholine receptor (nAChR), which successively stimulate the activity of cholinergic receptors, ends in hyper-excitation and insects death, In addition, they bind with receptors inside the central nervous system (CNS) of the organisms tightly (Casida, 2018).
Wang et al. (2019) claimed that androgen inhibition in male lizards could be resulted from thiamethoxam, whereas in female lizards, the expression of the hsd17β gene was upregulated in ovaries caused by thiamethoxam that resulted in plasma testosterone level increase with an increase in liver androgen receptor expression.
2.2.2. How thiamethoxam reaches water bodies?
Due to increased water solubility of thiamethoxam, Barbosa et al. (2016) supposed that it can be easily released from agricultural regions into the environment during its use, particularly after storm events.
Pesticides have various ways through which they can eventually find their way into aquatic environment as spray drift, run off and leaching (Shahjahan et al., 2017).
According to Borsuah et al. (2020), thiamethoxam half-life is 385-408 days in water and 6-3001 days in soil.
2.2.3. Harms conflicted upon fish due to exposure to thiamethoxam:
Bose et al. (2011) detected a marked lowering in growth and liver total protein in Nile tilapia as a result of thiamethoxam intoxication. Also, there is a strong relationship between O. niloticus’ hematological profile and thiamethoxam doses.
Nath et al. (2012) detected that O. niloticus to intoxication by a sublethal dose of thiamethoxam (>12.5 mg/L) affects liver total protein after 7 and 14 days markedly.
Stoyanova et al. (2016) mentioned that fish are sensitive to thiamethoxam water pollution.
Yan et al. (2016) mentioned that Thiamethoxam exposure induced damaging of DNA that detected by comet assay in Zebra fish liver at 0.30, 1.25, and 5.00 mg/L.
Baldissera et al. (2018a) demonstrated that a potential neurotoxicity was induced as a result of thiamethoxam exposure through targeting the brain purinergic signaling in silver catfish.
Baldissera et al. (2018b) claimed that the activity of cytoplasmic and mitochondrial creatine kinase severely impaired by Thiamethoxam exposure in both cytoplasm and mitochondria, besides it damaged the energy balance of cells, leading to oxidative stress.
Ghaffar et al. (2020) reported that pesticides at sublethal concentrations in aquatic environment results in metabolic abnormalities, behavioral changes and aquatic organisms’ death.
Temiz et al. (2021) clarified that a clear toxic impact was induced by pesticides on fish through rising of the reactive oxygen species amount.
Hussain et al. (2022) noticed that when thiamethoxam used at sublethal concentrations (0.5–2 mg/L), it led to serum biochemical and histopathological changes with DNA damage in freshwater fish.
Yang et al. (2023) observed that an enhancement in aggregation, locomotor and social activity of in adult Zebra fish after thiamethoxam exposure, but there was disruption in memory of the food zone with abnormalities in swimming behavior. Also, they added that exposure to thiamethoxam could lead to infiltration of erythrocytes, cloudy swelling, brain tissue necrosis, and other pathological alterations in tissues of the brain. Also, it affected the levels of both acetyl cholinesterase and cortisol related to the neurotoxic impacts.
2.3.1. Effects of thiamethoxam on water quality:
Firstly, water quality is considered chemical, physical, biological and radiological parameters of water. Decreased levels of dissolved oxygen (DO) is supposed to be a key reason for poor appetite, stress, reduced growth rate, sensitivity to diseases and increased mortalities in aquatic vertebrates. However, increasing pH causes alterations in processes of ion-exchange by gills causing a reduced capacity of osmoregulation, a rise in blood alkalosis with a decrease in ammonia excretion gradient through the gills into the adjacent water (Mwegoha et al., 2010 and Eruola et al., 2011).
Additionally, Boyd (2017) pointed out that there was a close relationship between aquatic animals health conditions and grow-out systems water-quality parameters, so any impairment in water quality can results in mortalities directly, but mostly, it increases susceptibility of infectious diseases through induction of stress in aquatic organisms.
Lobson et al. (2018) demonstrated that regarding water quality parameters, there was no significant difference before and after thiamethoxam application so they were not affected by the use of thiamethoxam. They observed during sampling days that there were significant differences in conductivity, pH, DO, TDN, hardness, temperature and alkalinity.
These results were detected when 0, 25, 50, 100, 250, and 500 μg/L of thiamethoxam were applied and monitored for 8 weeks.
Hasan et al. (2021) concluded that dissolved oxygen dramatically decreased by increasing thiamethoxam concentration and duration in water whereas no detected variations were observed for pH and temperature. Thiamethoxam was added to water by different doses (9.37, 18.75, 37.5, 75 and 150 mg/L) for 60 days during this duration water quality indices (e.g. temperature, DO and pH) was measured every 15days for detection of any change occurred.
Phillips et al. (2022) used three pesticides with different concentrations to evaluate their effect on dissolved oxygen (DO) in water. Methyl (244 µg/L, 266 µg/L and 92.1 µg/L), Clothianidin (4.89 µg/L, 2.11 µg/L and 1.15 µg/L for 96-h LC50, 10-day LC50 and 10-day IC25) and THX (56.4 µg/L, 32.3 µg/L and 19.6 µg/L) were added to water then dissolved oxygen was measured. Their findings revealed that dissolved oxygen levels of the 10-days experiment reduced below the optimum 2.5 mg/L threshold. Furthermore, higher pesticide levels resulted in lower oxygen concentrations.
2.3.2. Impact of thiamethoxam on fish growth:
Sweilum (2006) found that, dimethoate (20, 10 and 5 mg L−1) and malathion (2.0, 1.0 and 0.5 mg L−1) sublethal doses have made toxic effects on Nile tilapia, as there was a dramatic reduction (P<0.05) in specific growth rate, final body weight and fish normalized biomass index. On the other hand, these pesticides decreased fish survival rate with raising pesticides levels. Pesticides treatments affected the utilization of feed (feed conversion ratio, total food consumed and protein efficiency ratio) variably.
Gibbons et al. (2015) recorded that as imidacloprid, clothianidin and fipronil were not a cause of mortalities mainly among adults, these pesticides intoxication, can result in growth, development and reproduction reduction of individual vertebrates.
Chagnon et al. (2015) suggested that the higher the neonicotinoids levels in water bodies, the higher the alterations in the ecosystem functions occur regarded to the transmission of nutrients from primary producers to secondary consumers, leading to lowering of survival rates, growth, and reproduction in freshwater organisms, including fish and other water insects.
Velisek and Stara (2018) conducted an experiment to evaluate the toxicity of thiacloprid on the embryos and larvae common carp intoxicated with various concentrations of the insecticide: 4.5, 45, 225, and 450 μg/L for 35 days and a non-exposed control group. By the end of the study, carp subjected to 45 μg/L thiacloprid experienced a reduction in weight and length in comparison to non-treated group. In addition, use of 225 and 450 μg/L thiacloprid resulted in reduction in both fish weight and length.
Zhu et al. (2019) observed that when Chinese rare minnow was subjected to thiamethoxam at 0, 0.5, 5, and 50 μg/L for 90 days, there was a dramatic reduction in body length at 50 μg/L, while weight and hepatosomatic somatic index (HSI) increased significantly at 0.5 μg/L in males. Meanwhile in females, the body length was lowered in all intoxicated groups and there were non-significant changes in other parameters, including HSI and weight.
Dawood et al. (2020) proved that deltametherin intoxicated Nile tilapia exhibited a dramatic reduction in survival rate, weight gain, final body weights and specific growth rate (SGR), when they were intoxicated by subacute dose of deltametherin (15 μg/L) for 30 days.
Abdel-Tawwab et al. (2021) monitored Nile tilapia growth performance when exposed to 0.0 or 0.05 μg /L imidacloprid (IMI) for 8 weeks and found a marked decrease in the parameters of growth when compared to control one.
Hossain et al. (2022) suggested that when chlorpyrifos insecticide levels increased, SGR, weight gain and survival rate of O. niloticus were reduced as they were exposed to various chlorpyrifos doses for 60 days.
2.3.3. Effect of thiamethoxam on serum biochemical indices:
Shahjahan et al. (2022) suggested that hemato-biochemical parameters are a beneficial means to evaluate the effects of various pollutants to determine the fish health condition.
Kumar et al. (2010) mentioned that at thiamethoxam sublethal doses, biochemical indices in the serum of the fresh water fish, Channa punctuatus could be adversely affected, as there was an elevation in glucose, amino acid nitrogen (AAN), creatine, lactate, urea, bilirubin, tri acyl glycerol and non-esterified fatty acids (NEFA) and phospholipids levels, in contrast, the levels of protein, pyruvate, non-protein nitrogen (NPN) and albumin were decreased at different time intervals during the toxic exposure periods in the fish serum.
Ilahi et al. (2018) exposed grass carp and golden fish to 2 mg/l of imidacloprid for 28 and 24 days, respectively. They observed that albumin level in the serum was markedly lowered in the intoxicated groups of both fish species when compared to the control. Level of serum globulin in grass carp was insignificantly low however it was significantly low in golden fish. Moreover, the level of total proteins in serum of the either fish species was insignificantly lower related to control groups.
Vieira et al. (2018) argued that there was a substantial decrease of blood glucose in Prochilodus lineatus fish at different levels of imidacloprid (1.25, 12.5, 125, and 1250 μg L−1) for 120h revealing that there was an increase in energetic demands.
Américo-Pinheiro et al. (2019) observed that the level of total plasma protein in Nile Tilapia subjected to 14.050 and 28.1 mg/l of IMI, markedly decreased when compared to non-intoxicated group of fish.
Albinati et al. (2020) carried out a study to evaluate the toxicity of a thiamethoxam on Nile tilapia intoxicated by 32 mg/ L for 24, 48, 168, and 360 hours. They found that there was a lowering in the total protein with increased triglyceride levels of the treated one compared to the control. However, other indices didn’t show any differences between the exposed and control fish.
Veedu et al. (2022) detected a reduction in plasma protein levels in case of using individual and binary mixtures of acetamiprid and thiamethoxam for 96 h. In contrast, blood glucose level of all treatments increased significantly in a study performed on individual and mixed toxicity of acetamiprid and thiamethoxam in a freshwater fish Catla catla.
Mukherjee et al. (2022) recorded that Clarias batrachus experienced a marked rise in serum protein and globulin in contrast to serum albumin activity which was decreased at sublethal doses (6.93, 13.86 mg/l) of thiamethoxam at all exposure durations (15d, 30d, 45d). However, both triglycerides and glucose levels raised significantly at both the chronic doses (6.93 and 13.86 mg/l) of thiamethoxam in all exposure durations.
Desai and Parikh (2013) subjected O. mossambicus and Labeo rohita, to 21days sublethal doses of IMI and detected significant disruptions in various biochemical indices including; ALT, AST, ALP, and GDH. They explained that the increase of activities of these enzymes in fish tissues indicated liver damage that was linked to imidacloprid exposure.
Stoyanova et al. (2016) exposed bighead carp fish to 6.6 mg/l, 10 mg/l and 20 mg/l of thiamethoxam and observed that the activity of LDH, ALAT and ASAT showed an increase at all investigated concentrations.
El-Euony et al. (2020) subjected African catfish to thiamethoxam (5 mg L−1) for 1 month. Results showed an exceptional elevation of serum markers of hepatorenal injury such as ALT, ALP, AST, blood urea nitrogen (BUN) and creatinine levels of activity while there was a significant reduction of serum protein levels in TMX treated group.
Abdel-Tawwab et al. (2021) exposed Nile tilapia to imidacloprid (0.05 μg/L) and observed substantial high levels of aspartate and alanine aminotransferase, urea, alkaline phosphatase and creatinine in serum.
Mukherjee et al. (2022) carried out an investigation on Clarias batrachus fish subjected to different levels of thiamethoxam (6.93 and 13.86 mg/l) and the toxic impacts were determined at 15, 30, and 45days exposure intervals. On assessment of liver function test, a marked elevation was observed in cholesterol, HDL, LDL and VLDL levels was observed at both chronic doses.
Hussain et al. (2022) made an investigation on different groups of freshwater fish Labeo rohita exposed to 21h sublethal doses of thiamethoxam (0, 0.5, 1.0, 1.5, and 2.0 mg/L) to determine the possible genotoxic and serum biochemical implications. Significant raised concentrations of urea and creatinine were detected in thiamethoxam intoxicated fish. Also, the levels of liver function tests (AST, ALT and ALP) and function tests of the heart (cholesterol, triglycerides) were significantly increased.
2.3.4. Biochemical Oxidative stress markers:
Jin et al. (2010) stated that the inhibition of oxidative stress depends mainly on antioxidant enzymes (SOD, CAT, GPx and GST) as well as actions of these enzymes are monitored frequently to detect the risk of pesticides. In addition, Modesto and Martinez (2010) mentioned that malondialdehyde (MDA) is the final output of lipid peroxidation and this can be resulted when antioxidant defenses are not sufficient enough to prevent the excessive ROS that may be produced during the biotransformation reactions.
Yan et al. (2016) carried out a study on thiamethoxam (0.30, 1.25, and 5.00 mg/L) toxic impact on Zebra fish livers after 7, 14, 21, and 28 days. They concluded that ROS levels were elevated during the treatment period; a dramatic increase in SOD and CAT activities during the start of exposure and then prevented. GST level was only raised on 28 days. MDA activity experienced a slight increase on days 21 and 28.
Kocamaz and Oruc (2018) performed an investigation on thiamethoxam and lambda cyhalothrin synergistic impact on total oxidant status (TOS), oxidative stress index (OXI), total antioxidant capacity (TAC) and liver proteins, brain and gonad tissues of Nile tilapia. The fish exposed to7 and 15 days individual and mixed doses of thiamethoxam (1/20, 1/10 of 96h LC50) and lambda cyhalothrin (477.29 mg/L, 2.901 µg/L). Results showed an elevation in OXI and TOS while TAC levels were reduced in tissues.
Günal et al. (2019) subjected Nile Tilapia to sublethal levels of imidacloprid (50 and 100 mg/l) for 24 and 96 hr. By oxidative stress biomarker examination in both liver and gills tissues, there was a dramatic rise in MDA during all treatments in liver and gill tissues (except the low level of 24 h). Liver levels of SOD and glutathione peroxidase reduced at both concentrations and exposure durations, except for its increase at the 96 h high dose.
A study carried out by El-Garawani et al. (2021) for 21 days on two groups of
Nile tilapia that were subjected to sub-lethal doses of Imidacloprid (8.75 ppm, 1/20 of 72hLC50 and 17.5 ppm, 1/10 of 72h-LC50). They found that imididacloprid exposure resulted in significant (p˂ 0.05) changes in fish antioxidant profile of liver by elevating the activities and gene expression of SOD, CAT and GPX as well as ascending the levels of LPO. In an experiment on Nile Tilapia, exposure of fish to 50, 100, and, 150 mg/L of thiamethoxam for 48 h and 15 days was performed.
Temiz et al. (2021) observed that in liver and brain tissues, there was a dramatic reduction in levels of CAT and GSH, in addition to an elevation of SOD levels.
Hathout et al. (2021) suggested that, when juveniles of Nile tilapia exposed to 10 and 20 ppm acetamiprid (Aceta) for 21days, antioxidant enzymes activities (SOD and GPX) were dramatically reduced in fish exposed to 10 and 20 ppm of Aceta when compared to control. However, CAT levels showed a non-significant elevation among both Aceta-exposed groups.
2.3.5. Histopathological alliterations due to thiamethoxam toxicity in fish:
2.3.5.1. selection of gills and liver for toxicity detection:
Gardner et al. (2001) supposed that gills represent the main site for most water pollutants uptake as well as they were thought to be affected first by many of these toxic pollutants. In addition, gills are responsible for performing essential physiological processes besides they are sensitive to both structural and biochemical alterations of the branchial epithelium. Furthermore, Liver primarily plays a key role in biotransformation reactions, also it is indicated as an important organ in xenobiotics detoxification and accumulation of contaminants, due to this it is regarded as a helpful biomarker for toxicity assessment (Calitz et al., 2018; Nithyananthan and Thirunavukkarasu, 2019).
Huang et al. (2020) reported that in aquatic vertebrates, the gill serves as a primary mucosal immune organ, and fish healthy growth is closely related to the structural integrity of the gill. However, Zhang et al. (2023) reported that liver choosing as a target organ for performing studies helps to gain a deep knowledge of different aspects of fish physiology, health, and adaptability.
2.3.5.2. Gills histopathology:
Georgieva et al. (2014) investigated the impact of thiamethoxam on the histological structure of common carp gills. Fish subjected to 6.6, 10 and 20 mg/l thiamethoxam. Findings revealed various histopathological changes in the epithelium of the gills, which included lamellar lifting, edema, proliferation of the glandular cells and epithelium covering the gill filament, fusion and degenerative alterations besides the blood circulatory system vasodilatation. After 24 and 96 h of Nile Tilapia exposure to sub-lethal imidacloprid concentrations (50 and 100 mg/l), scarification of fish with gill tissues examination under microscope revealed epithelial lifting, fusion of secondary lamellae, hyperaemia and telangiectasia (Günal et al., 2019).
El-Euony et al. (2020) conducted a study on African catfish exposed to thiamethoxam (5 mg L−1) for 1 month. By histopathological examination of the gills, tissues revealed epithelial lifting and hyperplasia of the primary lamellae with multifocal partial or complete lamellar fusion, diffuse fusion of the secondary lamellae with epithelial lifting, hyperplasia of goblet cells, beside lamellar and filamentous epithelial cells necrosis and desquamation with edema, inflammatory cell infiltrations, and hemorrhage.
A study performed by Ghaffar et al. (2020) on fresh water fish (Labeo rohita), in this study fish were exposed to various concentrations of Thiamethoxam (0, 0.5, 1.0, 1.5 and 2.0 mg/l) for 120 hr. Microscopic analysis of gill tissues of different experimental fish exhibited atrophy of secondary lamellae, pyknosis of lamellar epithelial pillar cells, lamellar degeneration, congestion, aneurysm and curling of lamellae.
El-Garawani et al. (2022) conducted a study to examine the side effects of selected neonicotinoids (acetamiprid, Aceta, and imidacloprid, Imid) on Nile tilapia juveniles. Fish were exposed to 1/10 of the LC50 of both neonicotinoids for 21 days. Fish gills from the Aceta group (19.5 ppm) showed severe histopathological changes, the gills were edematous and suffered from hyperplasia, hemorrhage, and fusion of the secondary lamellae. However, fish gills from the Imid-exposed group (15 ppm) severely showed a serious of histopathological changes, such as the dilatation of congested capillaries, hyperplasia and increased thickness of the epithelium of gill lamellae.
2.3.5.3. Liver histopathology:
Ansoar-Rodríguez et al. (2016) performed an investigation on Liver tissues collected from O. niloticus exposed to 250, 125 and 62.5 mg/l of imidacloprid for 96h. By microscopic examination, hydropic degeneration, pyknotic nucleus, cytoplasmic vacuolations and loss of cell limits were noticed. Hyperemia, mononuclear cell infiltration, hepatocytes vacuolization and hydropic degeneration were observed under microscope.
In an experiment on African catfish, fish were exposed to THX (5 mg L−1) for 1 month. Liver tissues experienced pathological changes including, vacuolation of hepatocytes which is hydropic and fatty one associated with pyknotic and eccentric nuclei, necrosis of hepatocytes with mononuclear cells and perivascular mononuclear cell infiltrations, hemorrhage and marked activation of MMCs (El-Euony et al., 2020).
Hasan et al. (2023) conducted a study to investigate the effect of thiamethoxam insecticide on liver tissue of Banded Gourami (Trichogaster fasciata). Fish were subjected to 9.37, 18.75, 37.5, 75, and 150 mg/L of Thiamethoxam for 90 days and by histopathological assessment of liver tissues of different groups, there was fatty degeneration, acute cellular swelling, autolysis, vacuolation and necrosis.
2.3.6. Application of Real Time PCR technique for detection of growth, immunity and stress genes:
2.3.6.1. Growth related genes (gherlin):
Unniappan and Peter (2005) suggested that, ghrelin which was described as the 1st recognised endogenous ligand of the growth hormone secretagogue receptor, was purified originally in rats and humans. Moreover, it is a peptide hormone that results in controlling of a number of physiological functions like releasing of pituitary hormones and stimulating food intake in fish.
According to Fox et al. (2009) ghrelin which is secreted by the stomach, is a highly conserved hormone involved in food intake and energy expenditure regulation. Growth hormone (GH) release was stimulated by ghrelin release with increasing the appetite in different types of vertebrates, including various fish species.
Furthermore, the GH-secretagogue (ghrelin) receptor is a typical Gprotein-bound receptor found in several species of aquatic vertebrates. However, the hypothalamus, pituitary, brain, alimentary tract, and liver are considered sites for GHS-R mRNA detection in most fish species although the precise tissue distribution differs (Chan and Cheng, 2004; Jönsson, 2013).
Additionally, ten years ago ghrelin was detected firstly in fish as a hormone of beneficial roles in the food intake and metabolism regulation. According to Jönsson (2013), exposing O. niloticus and goldfish to ghrelin treatment results in food intake increase with stimulation of lipogenesis and tissue fat deposition which accounted for a more positive energy state in fish.
Moreover, Zhong et al. (2021) supposed that, ghrelin which is mainly secreted in gut, is a peptide hormone involved in variable physiological body functions. Processes like growth, food intake, energy balance, and reproductive process can be controlled by ghrelin hormone. Suggestive recent evidences revealed that ghrelin is also associated with hypothalamic– pituitary–gonadal axis (HPG axis) and enters in regulation of gametes maturation.
2.3.6.2. Impact of thiamethoxam on ghrelin expression:
Sánchez-Bayo and Goka (2005) suggested that imidacloprid insecticide dramatically reduced both weight and length of Japanese medaka fry when treated with Admire GR (1% imidacloprid) at a rate of 215 g a.i./ha. This treatment is conducted in two fields contained rice seedlings; in addition, the used dose is about 1.5 times the optimum application rate on commercial rice fields.
Furthermore, Lal et al. (2013) supposed that catfish experienced a reduction in the levels of growth hormone (GH) and thyroxine (T4) when fish are subjected to malathion at 0.001 ml/liter and 0.0001 ml/liter.
In contrast, Marlatt et al. (2019) found that clothianidin had no significant impact on expression of growth genes of embryonic, alevin and early swim-up fry sockeye salmon (Oncorhynchus nerka) after a 4months experiment by using different clothianidin treatments (0.15, 1.5, 15 and 150 μg/L).
Furthermore, Vignet et al. (2019) observed that imidacloprid resulted in sublethal impact on Zebrafish and Japanese medaka, although in medaka the impact was much stronger with decreased growth, deformities and lesions were the most observed effects. In this study, imidacloprid was applied at various concentrations from 0.2 to 2000 μg/L for 5 (zebrafish) and 14 (medaka) days through aquatic exposure.
According to Victoria et al. (2022), there was an observed impairment in hatching and growth of zebrafish in early life after chronic exposure to different concentrations of thiamethoxam (TM) or nicotine (NIC) at ≥0.21 µg TM/l or 4.9 µg NIC/l while performing a study on the effect of both chemicals on fish health.
On the contrary, Abdel Rahman et al. (2023) detected a significant reduction (p < 0.05) in growth, economic value, acetylcholine esterase, glucose concentration and antioxidant capacity of African catfish (Clarias gariepinus) subjected to imidacloprid (1/5 LC50: nominal 2.03 μg/L) and sampled after 2 months of intoxication.
2.3.6.3. Oxidative stress gene expression (catalase):
Gayashani Sandamalika et al. (2021) mentioned that catalase which is an important enzyme in the antioxidant defense mechanism of organisms, scavenges free radicals to prevent their harmful impacts on the host with proper immune function support.
2.3.6.4. Impact of thiamethoxam on catalase expression:
Tian et al. (2018) observed a marked reduction in catalase expression levels (p < 0.05) of juvenile Chinese rare minnows under 0.1 and 0.5 mg/L nitenpyram intoxication. This result was observed when fish were subjected to 0.1, 0.5 and 2.0 mg/L of imidacloprid and nitenpyram for 60 days to study their toxic effect on the brain of juvenile Chinese rare minnows.
Furthermore, Qi et al. (2018) conducted a study to evaluate the effect of three neonicotinoid insecticides (cycloxaprid (CYC), guadipyr (GUA) and imidacloprid (IMI)) on Daphnia magna, aquatic flea. They were intoxicated by sub lethal concentrations of IMI, CYC and GUA (1.25, 2.5, and 5.0 mg/L) for 48h. Results showed that, catalase gene expression was markedly downregulated by IMI and GUA, although it was up-regulated by CYC.
Tian et al. (2020) found a dramatic down regulation of catalase gene expression in 0.1 and 0.5 mg/L nitenpyram and 0.5 mg/L dinotefuran (0.59-, 0.53- and 0.59-fold, respectively; p < 0.05) intoxicated juvenile Chinese rare minnows when they were exposed to 0.1, 0.5, or 2.0 mg/L neonicotinoid insecticides (imidacloprid, nitenpyram, and dinotefuran) for 60 days.
El-Garawani et al. (2021) carried out a research on Nile tilapia (Oreochromis niloticus) exposed to different concentrations of imidacloprid. Fish were subjected to 8.75 ppm, 1/20 of 72 h-LC50 and 17.5 ppm, 1/10 of 72 h-LC50 of imidacloprid for 21 days. Results revealed marked disruption in the antioxidant profile of the imididacloprid intoxicated fish livers with an increase in the expression and activities of SOD, CAT and GPX as well as an elevation in the concentrations of LPO.
In addition, Ahmed et al. (2022) supported the previous results by finding a significant down regulation of the antioxidant enzymes (sod and cat) gene expression in Nile Tilapia liver when fish exposed to 1/5 of atrazine (herbicide) 96-h lethal concentration 50 (1.39mg/l).
2.3.6.5 Immunity genes (TLR2):
According to Samanta et al. (2012) Toll-like receptors (TLRs) are among the valuable constituents of innate immunity. Among the different types of TLR, TLR2 plays a key role in recognition of specific microbial structures such as peptidoglycan (PGN), lipoteichoic acid (LTA), zymosan etc., and after attaching with them it stimulates myeloid differentiation primary response gene 88 (MyD88)-dependent signaling pathway in order induce various cytokines.
2.3.6.6. Impact of thiamethoxam on TLR2 expression:
Moreover, in a recent study made by Khalil et al. (2020) to evaluate immunotoxic impacts of the lambda cyhalothrin (LCH) insecticide on O. niloticus fish, fish was sampled following 30-days exposure to LCH (1/6 LC50: 0.48 μg/L). Results revealed a downregulation in expression of Interferon (IFN-γ) Immunoglobulin M heavy chain (IgM), CXC-chemokine, and Toll-like receptors (TLR-7) levels in the spleen.
In contrast to Zhao et al. (2020) argued that cypermethrin and sulfamethoxazole caused upregulation in transcriptional level of genes enter in Toll-like receptors (TLR) signaling pathway of grass carps intoxicated spleens when fish subjected to 42 days cypermethrin (CMN, 0.651 μg/L) or/and sulfamethoxazole (SMZ, 0.3 μg/L) in order to evaluate their effects on oxidative stress, immune response, DNA damage and apoptosis of fish spleen.
However, Tang et al. (2021) observed that diazinon caused significant downregulation in expression of TLR4, MyD88, NF-kB p100 and IL-8 genes while there was no significant change in TNF-α (P = 0.8239) under treatment of crucian carp with 300 μg/L of diazinon for 21 days to determine its effect on innate immunity genes.
Mohamed et al. (2022) conducted a study to evaluate the impact of Voliam flexi® 40% WG (thiamethoxam + chlorantraniliprole) on Clarias gariepinus. Beside a control group, fish were intoxicated by 3 sublethal concentrations of Voliam flexi® (43.5, 87.5, and 175 mg/L) for 15 days. Immunotoxic changes was induced by Voliam flexi® in C. gariepinus, including a decrease in several immunity indices (lysozyme and phagocytic activity, immunoglobulin levels, and nitro blue tetrazolium level). Additionally, it caused an elevation of primary cytokines levels (interleukin-1β and IL-6), in relation to the control group.
In addition, Yang et al. (2023) mentioned that after 24h of acute toxicity test with Thiamethoxam (300 µg/L), there was marked upregulation in the expression levels of Tolllike receptors genes (including TLR1 and TLR2) and LITAF in Chinese mitten crab (Eriocheir sinensis) when fish exposed to 0 µg/L, 150 µg/L and 300 µg/L of thiamethoxam for 96h. The experiment was performed to explore the impact of thiamethoxam on inflammatory signaling pathway-related genes.
2.3.7. Thiamethoxam residues and bioaccumulation:
2.3.7.1. Impact of thiamethoxam on human health:
Seltenrich (2017) indicated that altered neurological or developmental outcomes such as memory loss, congenital anencephaly, autism spectrum disease and tetralogy of Fallot, would arise due to prolonged exposure to neonicotinoids.
In addition, Mesnage et al. (2018) claimed that neonicotinoids could have adverse effects on could cause adverse reproduction, development, and physiology of humans, involving reduction of sperm output and function, decreased pregnancy rate, raised fetal mortalities, still-birth rate, and preterm birth rate, with reduced weights and lipid accumulation in the offspring.
Moreover, Thompson et al. (2020) mentioned that the little knowledge from crosssectional or ecological epidemiological studies has revealed that neonicotinoid exposure in human results in acute and chronic health impacts varying from acute signs of respiratory, cardiovascular, and neurological damage to oxidative genetic damage and birth abnormalities.
2.3.7.2. Thiamethoxam residues in fish:
According to Sweilum (2006) pesticide residues observe to increase in the flesh, liver and gills of Nile tilapia with increasing pesticide concentrations in fish ponds. Particularly, the pesticides higher bioaccumulation was observed in liver than in gill or flesh, as fish flesh revealed the lowest residues levels for these pesticides when fish subjected to sublethal doses of dimethoate (20, 10 and 5mg L_1) and malathion (2.0,1.0 and 0.5mg L_1) for 24 weeks.
In the same vein, Abd El-hameed et al. (2021) found an increase in imidacloprid (IMID) levels of residues in Nile tilapia flesh and liver tissues when exposed to a sub-lethal dose of IMID (0.0109 μg/L) for 14 days.
Unlike Iturburu et al., Guedegba et al. (2021) argued that, Nile tilapia exposed to sublethal concentrations of Acer 35 EC (a binary mixture of lambda-cyhalothrin and acetamiprid) at (0, 1 and 10% of LC50- 96 h value) then after 28 and 56 days of exposure muscle samples were collected. The results showed that regardless of the exposure duration, fish muscles intoxicated by higher Acer 35 EC concentration had increased residues concentrations of both lambda-cyhalothrin and acetamiprid.
Likewise, Yang et al. (2022) published a paper about the bio-uptake, tissue distribution and metabolism of neonicotinoids in zebrafish tissues, taking clothianidin (CLO) insecticide as an example for neonicotinoids. The findings revealed that the highest accumulation for CLO was found in intestine and liver, whereas the lowest level was observed in muscles.
Furthermore, Wang et al. (2022) suggested that, the concentrations of neonicotinoids in freshwater around the world were expected to range from 10.6 (6.88– 23.4) (thiacloprid) to 339 (211–786) ng/L (thiamethoxam) with estimated risk quotients ranged from 3.23 (dinotefuran) to 21.73 (thiacloprid).
Similarly, Yang et al. (2023) demonstrated that in adult zebrafish subjected to 3 concentrations of thiamethoxam (THM) (0.1, 10, and 1000 μg/L) for 45 days, in conclusion, residues of THM were detected in fish brain tissues in all intoxicated groups with the maximum brain residual concentration observed at 1000 μg/L treatment group which was significantly higher when compared with other groups (p < 0.05).
A recent investigation made by Zhang et al. (2023) about thiamethoxam (TMX) residual concentrations in red swamp crayfish tissues exposed to 10 ppt of thiamethoxam insecticide for 7days. The results supported the previous studies by showing a dramatic increase in Thiamethoxam content in the muscles and hepatopancreas of the exposed group (P < 0.05) when compared to the control one.
According to Wang et al. (2023), TMX is widely found in a variety of matrices in the environmental matrices likewise in food and human samples. Also TMX detection rate in global surface water was 81.3 %, with the values ranging from 0.002 to 4315 ng/L.
2.3.8. Mortalities induced by thiamethoxam exposure:
Ullah and Zorriehzahra (2014) mentioned that usually pesticides at acute doses leads to fish mortality whereas sub lethal concentration lead to various lethal effects. These effects may be behavioral changes of the intoxicated fish including abnormal feeding behavior, avoiding or attacking behavior and reproductive behavior, besides other types of changes such as histopathological changes in various organs, hematological changes, antioxidant defense system alterations (Peroxidase, Catalase, Glutathione reductase, Superoxide dismutase, Glutathione peroxidase, Glutathione-Stransferase etc.), nutrient profile abnormalities (Lipids, proteins, Carbohydrates and Moisture content), changes in hormonal or enzymatic profiles, and genotoxicity.
Moreover, Albinati et al. (2016) found a direct relationship between mortalities rates of Nile tilapia fingerlings and increased thiamethoxam insecticide concentration during an experimental trial, in which tilapia were exposed to 150, 300, 450, 600 and 750mg / L Actara.
Mukherjee et al. (2022) clarified that freshwater walking catfish death rate increased with an elevation in the exposure dose of thiamethoxam and treatment duration as they were subjected to different acute doses of Actara® (105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175 and 180 mg L−1).
3. MATERIAL AND METHODS
3.1. Ethical approval:
The experiment was approved by Institutional Animal Care and Use Committee (IACUC) Alexandria University (225).
3.2. Location of the experiment:
The present study was carried out in the laboratory of Fish diseases department, Animal Health Research Institute, Alexandria branch, Egypt during the period extended from 10 July to 10 August, 2023 to evaluate the effect of water pollution by Thiamethoxam insecticide on health condition of Nile tilapia (Oreochromis niloticus).
3.3. Experimental design:
The experiment was scheduled for three weeks to evaluate the toxic effects of Thiamethoxam insecticide on the health status of fish through determination of some biochemical parameters in fish serum, histopathological changes in liver and gills of fish beside molecular detection of growth and immunity gene expression and lastly determination of insecticide residue in fish flesh. The used insecticide was Actara 25 WG manufactured by Sygenta, Egypt and it was purchased from Egyptian Company for Seeds and Agricultural Chemicals. It composed of 250 g/kg thiamethoxam, 3-(2chlorothiazol-5ylmethyl)-5-methyl-(1,3,5) oxadiazinan-4-yldene-N-nitroamine and 750 g/kg inert ingredients.
A total of 200 O. niloticus with an average initial weight of 15 ± 5 g have been obtained from a commercial fish farm in Kafr Elsheikh province, Egypt. They were transported in safe oxygenated tanks. After that, they were placed upon arrival in 100 L glass aquaria provided with artificial aeration. Fish were kept for acclimatization for seven days in chlorine free water where they were given feed twice daily. Fish were given pelleted feed (Skretting Egypt, 30 % crude protein at a rate of 3% of fish body weight). A biweekly partial water exchange with the help of siphoning tube that remove wastes and feed residues from all the aquariums and keep them clean as much as possible was performed. After that, fish were randomly allotted to five replicated treatments. They were kept at a density of 10 fish / aquaria. Four different concentrations of the insecticide were tested with three replicates of fish for each treatment beside a control group where with no insecticide were used (Table, I). Tested concentrations of studied insecticide was selected according to lethal concentration 50 (LC50 for Thiamethoxam was 500 mg/l) where chronic treatments were 1/20 (5%) and 1/10 (10%) of LC 50 while subacute treatments were 2/10 (20%) and 5/10 (50%) of LC 50.
Table (I): Description of experimental fish groups to evaluate effects of thiamethoxam
Treatment (T) Fish groups Thiamethoxam
Dose Duration
T1 Control group No insecticide 21 days
T2 Low chronic dose 25 mg/l 21 days
T3 High chronic dose 50 mg/ l 21 days
T4 Low subacute dose 100 mg/ l 4 days
T5 High subacute dose 250 mg /l 4 days
3.4. Evaluation of water quality of aquaria:
For dissolved oxygen (DO), a portable oxygen meter (Microprocessor Oxygen Meter HI 9143, HANNA instruments) was utilized. The pH was calculated using a portable AD 11 Waterproof pH meter, and the water temperature was monitored using a TH310 Pocket-sized Thermometer with an automated calibration check to keep the water chemistry within permissible norms (Boyd and Tucker, 2012), which were as follows: pH (7.7 ± 0.1); temperature (22± 1).
As well salinity and oxygen saturation percentage were determined to assess the impact of Thiamethoxam on these water quality parameters and these parameters were measured at Water Pollution and Marine Environment Lab., Institute of Graduate Studies and Research.
3.5. Samples used:
• Serum samples for biochemical analysis.
• Liver and gills samples for histopathological examination.
• Extracted liver samples in RNA latter for RT-PCR analysis.
• Fish samples for residues evaluation.
3.6. Biweekly fish weighting:
It was performed to determine both final weights and weight gain of fish.
3.7. Serum biochemical analysis:
The following biochemical parameters were determined in different experimental groups including liver and kidney function tests beside some metabolic parameters.
Table (II): Determination of serum biochemical indices
Serum biochemical Assay method Reference
Total protein BioMed Total Protein kits Gornal et al.,
(1949)
Serum albumin BioMed Albumin kits Duomas et al.,
(1971)
Serum globulin Globulin = Total protein − Albumin Duomas et al.,
(1971)
Glucose GLUCOSE MR kits McMillin, (1990)
Alanine aminotransferase
(ALT) Alanine aminotransferase (ALT/GPT) - Ultimate Single Reagent E.C.2.6.1.2 kits Reitman and
Frankel, (1957)
Aspartate aminotransferase
(AST) Alanine aminotransferase (ALT/GPT) - Ultimate Single Reagent E.C.2.6.1.2 kits Reitman and
Frankel, (1957)
Urea Urea kits Fawcett and
Scott, (1960)
Creatinine Creatinine kits Bartels et al., (1972).
Triacylglycerol (TAG) Triacylglycerol kits Fossati and
Prencipe, (1982).
Cholesterol Cholesterol kits Allain et al.,
(1974).
HDL High density lipoprotein kits Yeates et al.,
(1979).
LDL Low density lipoprotein kits Hoffmann et al.,
(1982).
VLDL Very low density lipoprotein kits
3.8. Assay of serum total antioxidant capacity (TAC), superoxide dismutase (SOD) activity and Malondialdehyde (MDA):
The serum antioxidant activities were monitored using Sunostick Sba733 spectrophotometer multi-parameter analyzers. TAC was measured employing Total Antioxidant Capacity Colorimetric methods according to Koracevic et al., (2010). Superoxide dismutase (SOD) was assessed according to Nishikimi et al., (1972) (SD 25 21), while Malondialdehyde (MDA) was measured using Malondialdehyde (Colorimetric method) MD 25 29 kits according to Ohkawa et al. (1979).
3.9. Histopathological examination for gills and liver:
After the end of the experiment, fish were sacrificed and gill and liver tissues were excised from the five treatments (three fish per replicate from each treatment). Tissues were then fixed in 10% neutral formalin for 48 h. This was followed by dehydration in alcoholic grades, clearing in xylene and embedding in paraffin wax. 5 μM thick sections were cut in an automated microtome (RM-2155, Leica) followed by double staining using haematoxylin-eosin. The slides were mounted in distyrene plasticizer xylene (DPX) and visualized under a binocular research microscope attached to a digital camera (Model:
DIGI510, Dewinter biological microscope with 5.1 MP camera, 1/2.5″ Aptina CMOS sensor) (Mukherjee et al., 2022).
3.10. Real time PCR analysis:
It was performed at Biotechnology unit at Reference lab for veterinary quality control on poultry production, Animal health research institute, Dokki, Giza, Egypt.
Table (III): Oligonucleotide primers and probes used in SYBR Green real time PCR (Metabion, Germany)
Gene Primer sequence (5’-3’) References
EF-1α CCTTCAACGCTCAGGTCATC Gröner et al., (2015)
TGTGGGCAGTGTGGCAATC
TLR2 CCCACAATGGATTCACCAG Midhun et al., (2019)
AAAGATCAAGACTCAAGGCACTG
Ghrelin GCAGAAGACTTGGCGGACTACAT Zou et al., (2017)
ATAAACCAGAAAGAAGGGACAACC
CAT TCCTGAATGAGGAGGAGCGA Afifi et al., (2016)
ATCTTAGATGAGGCGGTGATG
3.10.1. Extraction of RNA According to RNeasy Mini Kit instructions:
• Thirty mg of organ sample was weighed and put in 2 ml screw capped tubes.
• 600 μl of Buffer RLT (with 10 μl ß-Mercaptoethanol/ ml Buffer RLT) was added into the tubes.
• For homogenization of samples, tubes were placed into the adaptor sets, which are fixed into the clamps of the TissueLyser.
• Disruption was performed in 2 minutes high-speed (30 Hz) shaking step.
• The lysate was centrifuged for 3 min at 14000 rpm.
• One volume of 70% ethanol was added to the cleared lysate, and mixed immediately by pipetting.
• Up to 700 μl of the sample transferred to an RNeasy spin column placed in a 2 ml collection tube. Centrifugation was done for 1 min. at 14000 rpm. The flow-through was discarded.
• Step 6 was repeated again for the excess volume.
• 700 μl of Buffer RW1 was added. Centrifugation was done for 1 min. at 10000 rpm. The flow-through was discarded.
• 500 μl of Buffer RPE was added. Centrifugation was done for 1 min. at 10000 rpm. The flow-through was discarded.
• Step 9 was repeated again, but Centrifugation was done for 2 min. at 10000 rpm.
• RNA was eluted by adding 50 μl RNase-free water. Centrifugation was done for 1 min. at 10000 rpm.
3.10.2. Preparation of PCR master Mix according to Quantitect SYBR green PCR kit:
Component Volume/reaction
2x QuantiTect SYBR Green PCR master Mix 12.5 μl
Reverse transcriptase 0.25 μl
Forward primer (20 pmol) 0.5 μl
Reverse primer (20 pmol) 0.5 μl
RNase Free Water 8.25 μl
Template RNA 3 μl
Total 25 μl
3.10.3. Cycling conditions for SYBR green real time PCR according to Quantitect SYBR green PCR kit:
Targe
t gene Reverse transcripti on Primary denaturati on Amplification (40 cycles) Dissociation curve (1 cycle)
Secondary denaturati on Anneali ng
(Optics on) Extensi on Secondary denaturati on Anneali ng Final denaturati on
EF-
1α 50˚C
30 min. 94˚C
15 min. 94˚C 15 sec. 62˚C
30 sec. 72˚C 30 sec. 94˚C 1 min. 62˚C
1 min. 94˚C 1 min.
TLR2 60˚C
30 sec. 60˚C 1 min.
Ghreli n 59˚C
30 sec. 59˚C
1 min.
CAT 60˚C
30 sec. 60˚C
1 min.
3.10.4. Analysis of the SYBR green rt-PCR results:
Amplification curves and Ct values were determined by the strata gene MX3005P software. To estimate the variation of gene expression on the RNA of the different samples, the CT of each sample was compared with that of the control group according to the ”ΔΔCt” method stated by Yuan et al. (2006) using the following ratio: (2- ct). Whereas ΔΔCt = ΔCtreference - ΔCttarget
ΔCt target = Ct control – Ct treatment and ΔCt reference = Ct control- Ct treatment.
3.11. HPLC analysis of Thiamethoxam residues in fish flesh:
The tests were performed at Agricultural Research Center, Central Laboratory of Residues Analysis of Pesticides and Heavy Metals in Food, Dokki, Giza, Egypt, through Quick and easy method (QuEChERS) for determination of pesticide residues in food using LC-MSMS, GC-MSMS. (European Standard Method EN 15662:2018 with a method named; QuEChERS Method Fatty).
3.12. Determination of Mortality rate:
Mortalities were determined throughout the experiment duration to determine the impact of Thiamethoxam on fish survival.
3.13. Statistical analysis
All the gathered data were analyzed for normality using the Shapiro– Wilk test. Then, one-way ANOVA was assessed to conduct a statistical evaluation of the results from the differently treated fish gathering under SAS (2009). Duncan’s multiple range tests were applied as well to detect any anticipated significant differences between treated fish groups at a significant level of 95%.
4. Results
1. Water quality parameters:
Table (1): Mean values of some parameters regarding water quality after using different levels of thiamethoxam insecticide
PH DO (mg/l) DO % Salinity (PSU)
Control 7.70 ± 0a 7.80 ± 0a 91.14 ± 0a 0.134 ± 0b
Low chronic dose 7.08 ± 0b 7.80 ± 0a 82.37 ± 0b 0.134 ± 0b
High chronic dose 7.07 ± 0c 7.20 ± 0b 76.03 ± 0c 0.124 ± 0d
Low subacute dose 6.87 ± 0d 6.90 ± 0c 72.86 ± 0d 0.128 ± 0c
High subacute dose 6.83 ± 0e 6.70 ± 0d 70.75 ± 0e 0.144 ± 0a
Means within the same column with different superscripts are significantly different (p<0.05).
Data exhibited in Table (1) and Fig. (1) illustrates some water parameters after using different levels of thiamethoxam insecticide. Statistically, in pH, dissolved oxygen levels (DO), oxygen saturation percentage (DO%) and salinity, there were significant differences between different thiamethoxam treated groups and the control group, where the lowest significance observed regarding the pH, DO and DO% was at the high subacute dose while in salinity it was at the high chronic dose with the highest significance at the high subacute dose. Furthermore, PH, DO and DO% values decreased with increasing thiamethoxam concentration in water. Consequently, PH value decreased after 3weeks treatment to be nearly 7.08 at the low chronic dose (25mg/l) and 7.07 at the high chronic dose (50mg/l) when related to the control group that was about 7.7. Similarly, in the 96h low subacute dose (100mg/l) PH reached 6.87 as well the high subacute dose (250mg/l) markedly lowered the PH to be 6.83. Additionally, DO in the unexposed water was 7.8mg/l with the same value observed in the 3weeks low chronic dose (25mg/l) while the high chronic dose (50mg/l) showed lower DO (7.2mg/l). On the other hand, in 96h low subacute dose (100mg/l) decreased the DO to become 6.9mg/l while it was 6.7mg/l at the high subacute dose (250mg/l). Moreover, oxygen saturation at the untreated water was
91.14% while after 3weeks treatment by low chronic dose (25mg/l) of thiamethoxam it was 82.37% and decreased to 76.03% at the high chronic dose (50mg/l). In the same vein, DO% lowered at 96h low subacute dose (100mg/l) to be 72.86% and 70.75% at the high subacute dose (250mg/l). Lastly, salinity detected in both unexposed water and 3weeks low chronic dose (25mg/l) was 0.134PSU while in the high chronic dose (50mg/l) was 0.124PSU. In addition, in 96h low subacute dose (100mg/l), it was 0.128PSU but it increased markedly in the high subacute dose (250mg/l) to become 0.144PSU.
Fig. (1): Mean values of some parameters regarding water quality after using different levels of thiamethoxam insecticide
2. Growth rate and weight gain:
Table (2): Effect of thiamethoxam insecticide on growth rate of Nile tilapia
Productive parameters Initial wt Final wt ± SD Wt gain ± SD
Treatment Means ± SD Means ± SD Means ± SD
Control 15.17 ± 0.026a 25.35± 0.15a 10.22 ± 0.081a
Low chronic dose 15.13 ± 0.043a 21.21 ± 0.13c 6.42 ± 0.47b
High chronic dose 15.14 ± 0.13a 20.57 ± 0.17d 5.43 ± 0.19c
Low subacute dose 15.14 ± 0.028a 24.77 ± 0.44b 9.69 ± 0.48a
High subacute dose 15.20 ± 0.035a 24.34 ± 0.49b 9.80 ± 0.097a
Means within the same column with different superscripts are significantly different (p<0.05)
As presented in Table (2) and Fig. (2) showed the effect of thiamethoxam
insecticide on growth rate of Nile tilapia. Statistically, there was a significant difference in final weight and weight gain of all treatments when compared with the control group. In addition, the lowest significance in the final weight and weight gain was observed at the high chronic dose while there was no significant change between both subacute doses. It was recorded that the final weight decreased with increasing the chronic dose of thiamethoxam when compared with control group, as the low chronic dose (25 mg/l) was nearly 21.2 g with a weight gain about 6.4 g while the high chronic dose (50 mg/l) showed more decrease in final weight about 20.5 g with weight gain nearly 5.4 g after 3 weeks. In contrast, there was no obvious change in final weight and weight gain of both low (100 mg/l) and high (250 mg/l) subacute doses after 96h as the final weights were 24.3 and 24.7, respectively with a weight gain around 9.6 g since the start of the experiment.
Fig. (2): Effect of thiamethoxam insecticide on growth rate of Nile tilapia
Results
2. Biochemical indices:
Table (3): Biochemical parameter among different levels of thiamethoxam in Nile tilapia
34
Data in Table (3) and Fig. (3) revealed the effect of thiamethoxam on serum proteins, Statistically, there was no significant change between different treatments and the control one. It was estimated that serum protein increased with increasing thiamethoxam concentration when compared to the control one (4.39 g/dl). Consequently, after 3 weeks, low chronic dose (25 mg/l) showed no observed increase nearly 4.3 g/dl while the high chronic dose (50 mg/l) revealed rise in protein level about 4.6 g/dl. Furthermore, results of subacute doses after 4d showed that thiamethoxam raised the protein level compared to control group as the low subacute dose (100 mg/l) was nearly 4.43 g/dl and the high subacute dose (250 mg/l) showed 5 g/dl protein concentration and that was the highest value detected.
Fig. (3): Effect of thiamethoxam insecticide on serum protein in Nile tilapia Similarly, data illustrated in Table (3) and Fig. (4) demonstrated the effect of thiamethoxam insecticide on serum albumin (SA). Statistically, thiamethoxam had no significant change on SA at different treatments as well there was no difference between them and the control group. Additionally, results showed a raise in albumin concentrations as the concentrations of thiamethoxam increased, 3weeks chronic doses showed an increase of albumin as compared to control which was about 3g/dl with nearly 3.43g/dl albumin at low chronic dose (25mg/l) while high chronic dose (50mg/l) treatment showed higher SA about 3.72g/dl. Besides, SA in both 4d subacute doses experienced an increase in relation to the control group in which at low subacute dose (100mg/l) SA was about 3.13g/dl whereas at the high subacute dose (250mg/l), SA raised to 3.47g/dl.
Fig. (4): Effect of thiamethoxam insecticide on albumin level in Nile tilapia
The data exhibited in Table (3) and Fig. (5) revealed the effect of thiamethoxam on serum globulin in Nile tilapia. Statistically, thiamethoxam did not cause a significant difference between the control group and both chronic and subacute treatments. While there was a significant difference in SG level between both chronic and subacute doses with the lowest significance observed in the low subacute treatment. Moreover, there was an observed elevation in globulin level with increasing thiamethoxam doses, briefly, after 3 weeks of using chronic doses, the level of globulin in the low chronic dose (25mg/l) was about 1.81g/dl when compared to the control group which was nearly 1.71g/dl, furthermore, the high chronic dose (50mg/l) increased the level of globulin to approximately 1.95g/dl. In contrary to the chronic doses, 4d subacute doses resulted in decreasing globulin level in comparison with the un exposed group. As globulin levels at both low subacute dose (100mg/l) and high subacute dose (250mg/l) were about 1.30g/dl and 1.58g/dl, respectively.
Fig. (5): Effect of thiamethoxam insecticide on serum globulin in Nile tilapia
Regarding Table (3) and Fig. (6), data showed the effect of thiamethoxam insecticide on creatinine concentration in Nile tilapia. Statistically, there was a significant difference between high chronic dose and high subacute dose as compared to the control group, in addition the highest significant regarding creatinine level was observed at the high subacute dose while the lowest significance was at the low subacute one. Moreover, results reported that creatinine levels increased as thiamethoxam concentrations increased, compared to the un treated group (0.88mg/dl), low chronic dose (25mg/l) showed a slight increase in creatinine level about 0.89mg/dl while the increase in high chronic dose (50mg/l) reached nearly 0.96mg/dl after 3weeks treatment. Whereas in 96h treatment, creatinine level decreased slightly in low subacute dose (100mg/l) (0.85mg/dl), in contrast to the high subacute dose (100mg/l) which showed the highest creatinine level about 1mg/dl.
Fig. (6): Effect of thiamethoxam insecticide on creatinine level in Nile tilapia As shown in Table (3) and Fig. (7) showed the effect of thiamethoxam insecticide on urea level in Nile tilapia. Statistically, there were no significant differences between the control group and subacute doses while there was a high significance observed at the high chronic dose compared to other treatments. Furthermore, there was a slight rise in urea level after 3weeks low chronic dose treatment (25mg/l) about 21.84mg/dl besides the highest urea concentration observed (24.4mg/dl) was at the high chronic dose (50mg/l). In contrast, both subacute doses resulted in a slight decrease of urea levels, as urea levels at low subacute dose (100mg/l) was about 18.75mg/dl while at high subacute dose (250mg/l) was 19.3mg/dl.
Fig. (7): Effect of thiamethoxam insecticide on urea level in Nile tilapia
The illustrated data in Table (3) and Fig. (8) highlighted the effect of thiamethoxam insecticide on glucose level in Nile tilapia. Statistically, no significant differences were detected between all the treated groups and the control group as well. As a consequence of 3weeks thiamethoxam treatment, glucose level was observed to be increased with increasing the intoxication dose. As the low chronic dose (25mg/l) resulted in glucose level about 75.5mg/dl whereas the high chronic dose (50mg/dl) resulted in 89.01mg/dl when compared to the control group that was nearly 70.8mgdl. On the other hand, after 96h treatment, glucose level showed no detected change at the low subacute dose (100mg/l) as it was 69.54mg/dl, in contrary to this, the high subacute dose (250mg/l) resulted in the highest level of all treatments which was about 94.03mg/dl.
Fig. (8): Effect of thiamethoxam insecticide on glucose level of Nile tilapia
The data presented in Table (3) and Fig. (9) represented the effect of thiamethoxam insecticide on alanine transaminase (ALT) level in Nile tilapia. Statistically, there were no significant differences in ALT level between all treatment doses and the control group except for the high chronic dose, besides it showed the highest significance of all treatments. However, results of 3weeks treatment with Thiamethoxam revealed an increase in ALT level by increasing the concentration of thiamethoxam. On brief, low chronic dose (25mg/l) resulted in ALT level about 10.8 U/L whereas the highest value (13.11 U/L) of all treatments was at the high chronic dose (50mg/l) while ALT level at the control group was 9.7U/L. However, the both 96h subacute doses caused a slight increase in ALT as compared to control group with no detected change between them as ALT level at the low subacute dose (100mg/l) was 10.8U/L while at high subacute dose was 10.34U/L.
Fig. (9): Effect of thiamethoxam insecticide on ALT level in Nile tilapia
Data in Table (3) and Fig. (10) illustrated the effect of thiamethoxam insecticide on aspartate transaminase (AST) level in Nile tilapia. Statistically, there were no significant differences between the un treated group and other treated ones, however, there were a significant differences observed between both low chronic dose and high subacute dose than other treated groups with the lowest detected significance at the low chronic dose. The represented findings suggested the compared to the AST level at the control group (48.6U/L), its level exhibited an observable increase with elevating thiamethoxam dose except for the low chronic dose. Hence, in 3weeks treatment, AST level at the low chronic dose (25mg/l) was nearly 41.43U/L whereas the high chronic dose (50 mg/l) led to an increase of this value to reach about 56.6U/L. Additionally, the 96h thiamethoxam treatment caused AST level to become almost 55.3 U/L at the low subacute dose (100 mg/l) and 66.62U/L, which was the highest level of all treatments, at the high subacute one (250 mg/l).
Fig. (10): Effect of thiamethoxam insecticide on AST level in Nile tilapia
Data in Table (3) and Fig. (11) revealed the effect of insecticide on cholesterol level in Nile tilapia. Statistically, no significant differences observed between treatment groups also between them and the control group. On the other hand, cholesterol level expressed an increase in its level only in the 3weeks high chronic dose (50mg/l) which was about 121.31mg/dl and 123.81mg/dl at the 96h low subacute dose (100mg/l) while the control group showed cholesterol level nearly 118.1mg/dl. In contrast, thiamethoxam low chronic dose (25mg/l) decreased cholesterol level at nearly 116.9mg/dl as well the high subacute dose (250mg/l) has led to 115.44mg/dl which was the lowest value for cholesterol of all treatments.
cholestrol
126
124
122
120
118
116
114
112
110
Control Low chronic High chronic dose dose Low subacute dose High subacute dose
Fig. (11): Effect of thiamethoxam insecticide on cholesterol level in Nile tilapia
Data in Table (3) and Fig. (12) explained the effect of thiamethoxam on triacylglycerol (TAG) level in Nile tilapia. Statistically, there were no significant differences between various treatment groups and the control one with exception to the low subacute dose that had the lowest significant change of all treatments. Furthermore, within 3weeks thiamethoxam decreased TAG level at the low chronic dose (25mg/l) to nearly 124.01mg/dl as compared to the control group that was 135.65mg/dl, in contrast to this thiamethoxam high chronic dose (50mg/l) resulted in a slight increase in TAG level (138.21mg/dl). Moreover, 96h thiamethoxam low subacute dose led to a marked decrease in TAG nearly 124.26mg/dl while the high subacute dose after 96h treatment resulted almost in no change in TAG level (135.58mg/dl) as compared with the control group.
Fig. (12): Effect of thiamethoxam insecticide on TAG level on Nile tilapia Data in Table (3) and Fig. (13) clarified the effect of insecticide on very low density lipoproteins (VLDL) level in Nile tilapia. Statistically, there were significant differences between various treatment groups and the control group except for both low chronic dose and high chronic dose that showed no significant changes with the lowest significance observed at the high chronic dose. However, while VLDL level at the untreated group was 26.13mg/dl, both 3weeks thiamethoxam low (25mg/l) and high (50mg/l) chronic doses have led to an increase in VLDL level to reach nearly 26.6mg/dl and 29.8mg/dl, respectively. Conversely, the 96h low subacute dose (100mg/l) decreased VLDL level (22.85mg/dl) whereas it showed an increase at the high subacute dose (250mg/l) to almost 27.10mg/dl.
Fig. (13): Effect of thiamethoxam insecticide on VLDL levels in Nile tilapia The represented data in Table (3) and Fig. (14) explained the effect of thiamethoxam on high density lipoproteins (HDL) level in Nile tilapia. Statistically, there were no significant differences in HDL levels between treatment groups and control one except for the high subacute dose which had the highest significance and the high chronic dose which represented the lowest significance. Furthermore, thiamethoxam was found to decrease the HDL level by increasing the treatment dose as compared to the control group that was 34 mg/dl. Consequently, HDL level at the low chronic dose (25 mg/l) after 3 weeks was 24.5 mg/dl while it was 20.24 mg/dl at the high chronic dose (50mg/l). Additionally, in 96h of using thiamethoxam, low subacute dose (100mg/l) decreased HDL to reach nearly 32.3 mg/dl, in contrast, the high subacute dose (250mg/l) markedly increased HDL level to become about 43.3mg/dl.
Fig. (14): Effect of thiamethoxam insecticide on HDL level in Nile tilapia Data in Table (3) and Fig. (15), illustrates the effect of on low density lipoproteins (LDL) levels in Nile tilapia. Statistically, no significant differences observed in LDL levels between thiamethoxam treated groups and control group. Findings demonstrated revealed that LDL level increased (62.13mg/dl) after 3weeks low chronic doses (25mg/l) when compared to the control group (54.63mg/dl), whereas the high chronic dose (50mg/l) resulted in lowering LDL levels (52.62mg/dl). Similarly, LDL level showed a marked increase in its value to reach almost 68.66mg/dl after 96h treatment with low subacute dose (100mg/l), in spite of this the high subacute dose (250mg/l) decreased LDL levels to be nearly 45mg/dl.
Fig. (15): Effect of thiamethoxam insecticide on LDL level in Nile tilapia
4. Oxidative stress indices:
Table (4): Oxidative stress parameters among different levels of thiamethoxam in Nile tilapia
Treatment groups SOD (U/ml)
Means ±SD MDA (mM/ml)
Means ±SD TAC (mM/ml)
Means ±SD
Control 3.27 ± 0.23a 1.05 ± 0.24b 21.83 ± 0.63a
Low chronic dose 3.07 ± 0.13a 1.41 ± 0.15a 18.90 ± 2.51ab
High chronic dose 2.94 ± 0.23a 1.58 ± 0.05a 17.70 ± 3.90ab
Low subacute dose 3.17 ± 0.46a 1.64 ± 0.04a 19.70 ± 0.43ab
High subacute dose 3.03 ± 0.52a 1.57 ± 0.11a 16.20 ± 2.81b
Means within the same column with different superscripts are significantly different (p<0.05).
Data exhibited in Table (4) and Fig. (16) clarified the effect of thiamethoxam insecticide on serum oxidative stress parameters in Nile tilapia. Statistically, there were no significant differences in super oxide dismutase (SOD) levels between thiamethoxam treated groups and the control group. Moreover, for malondialdehyde (MDA), no significant differences observed between the treated groups but there was significant difference between them and the control group. Furthermore, there were no significant differences in total antioxidant capacity (TAC) levels between thiamethoxam treated group and control group while the lowest significance observed was at the high subacute dose. However, thiamethoxam treatment resulted in decreasing the SOD levels in relation to the control group which was 3.27U/ml. Consequently, after 3weeks treatment with thiamethoxam, low (25mg/l) and high (50mg/l) chronic doses resulted in SOD levels about 3.07U/ml and 2.94U/ml, respectively. Whereas the 96h low subacute dose (100mg/l) has led to SOD level nearly 3.17U/ml besides high subacute dose (250mg/l) resulted in 3.03U/ml. In contrast, THX treatment caused an elevation in MDA levels when compared to the control group (1.05mM/ml). Hence, in 3weeks experimental trial, MDA level increased slightly (1.41mM/ml) at the low chronic dose (25mg/l) and raised to about 1.58mM/ml at the high chronic dose (50mg/l). In addition, the 96h low subacute dose
(100mg/l) showed increased MDA levels about 1.64mM/ml while the high subacute dose
(250mg/l) lead to 1.57mM/ml which was in fact lower than the low subacute one. Obviously, TAC levels decreased as THX treatment concentrations increased. As a consequence, 3weeks low chronic dose (25mg/l) resulted in TAC level about 18.9mM/ml whereas it reached 17.7mM/ml at the high chronic dose (50mg/l) when compared to the control group (21.83mM/ml). On the other hand, TAC in 96h low subacute (100mg/l) treatment was 19.7mM/ml while in high subacute one (250mg/l) was 16.2mM/ml and that was the lowest value recorded.
Fig. (16): Effect of thiamethoxam insecticide on oxidative stress parameters in Nile tilapia
5. Histopathological alterations of gills and liver of Nile Tilapia:
Exposure of Nile Tilapia to thiamethoxam toxicity has led to damaging of many organs including liver and gills which resulted in biochemical and genotoxic changes. Our results have illustrated typical pathological changes in both gills and liver tissues with no observed damage in the tissues of the non-exposed group of fish.
5.1. Gills pathological changes:
Photo (1): Gill of Nile Tilapia fish of the Control group showing normal primary and secondary gill lamellae. H&E. (X 100).
Photo (2): Gill of Nile Tilapia fish of T2 group (Thiamethoxam 25 mg/l /21 days) showing lamellar lifting (arrows) and congestion of branchial blood vessel (stars).
Photo (3): Gill of Nile Tilapia fish of T2 group (Thiamethoxam 25 mg/l /21 days) showing filamentous clubbing (arrow)
Photo (4): Gill arch of Nile Tilapia fish of T2 group (Thiamethoxam 25 mg/l /21 days)
showing eosinophilic granular cells (EGCs) infiltration (arrows) and congestion of blood vessel (stars).
Photo (5): Gill of Nile Tilapia fish of T3 group (Thiamethoxam 50 mg/l /21 days) showing lamellar telangiectasis (arrows)
Photo (6): Gill of Nile Tilapia fish of T3 group (Thiamethoxam 50 mg/l /21 days) showing unilateral fusion of secondary lamellae (short arrows)
Photo (7): Gill arch of Nile Tilapia fish of T3 group (Thiamethoxam 50 mg/l /21 days) showing hemorrhage (asterisks)
Photo (8): Gill of Nile Tilapia fish of T4 group (Thiamethoxam 100 mg/l /4 days) showing curved secondary lamellae (arrows)
Photo (9): Gill of Nile Tilapia fish of T4 group (Thiamethoxam 100 mg/l /4 days) showing
lamellar lifting (arrows)
Photo (10): Gill arch of Nile Tilapia fish of T4 group (Thiamethoxam 100 mg/l /4 days) showing eosinophilic granular cells (arrows) and congestion of blood vessel (stars)
Photo (11): Gill of Nile Tilapia fish of T5 group (Thiamethoxam 250 mg/l /4 days) showing unilateral fusion of secondary lamellae (short arrows).
Photo (12): Gill of Nile Tilapia fish of T5 group (Thiamethoxam 250 mg/l /4 days) showing lamellar lifting due to edematous separation of lamellar epithelium from capillary beds (arrows)
Photo (13): Gill arch of Nile Tilapia fish of T5 group (Thiamethoxam 250 mg/l /4 days) showing eosinophilic granular cells (arrows) and congestion of blood vessel (stars)
5.2. Liver pathological changes:
Photo (14): Hepatopancreas of Nile Tilapia fish of control group showing normal
hepatocytes. H&E. (X 400)
(15): Hepatopancreas of Nile Tilapia fish of T2 group (Thiamethoxam 25 mg/l showing congestion of central veins (star)
Photo (16): Hepatopancreas of Nile Tilapia fish of T2 group (Thiamethoxam 25 mg/l /21 days) showing diffuse hydropic degeneration of hepatocytes (arrows)
(17): Hepatopancreas of Nile Tilapia fish of T2 group (Thiamethoxam 25 mg/l showing activation in melanomacrophage centers (MMCs) (arrow)
Photo (18): Hepatopancreas of Nile Tilapia fish of T3 group (Thiamethoxam 50 mg/l /21 days) showing congestion of central veins (star)
(19): Hepatopancreas of Nile Tilapia fish of T3 group (Thiamethoxam 50 mg/l showing sharp edge outline vacuoles of hepatocytes (arrows)
Photo (20): Hepatopancreas of Nile Tilapia fish of T3 group (Thiamethoxam 50 mg/l /21 days) showing activation in MMCs (arrow)
Photo (21): Hepatopancreas of Nile Tilapia fish of T4 group (Thiamethoxam 100 mg/l /4 days) showing congestion of central veins (star) and eosinophilic granular cells (arrow)
Photo (22): Hepatopancreas of Nile Tilapia fish of T4 group (Thiamethoxam 100 mg/l /4 days) showing destruction and necrosis of pancreatic acini (arrow)
Photo (23): Hepatopancreas of Nile Tilapia fish of T5 group (Thiamethoxam 250 mg/l /4 days) showing activation in MMCs (arrow) and congestion of blood vessel (star)
Photo (24): Hepatopancreas of Nile Tilapia fish of T5 group (Thiamethoxam 250 mg/l /4 days) showing sharp edge outline vacuoles of hepatocytes (arrows)
6. Gene expression by RT-PCR:
Table (5): Impact of thiamethoxam insecticide on growth related, immunity and stress genes expression in liver of Nile tilapia
Gene expression GHERLIN TLR2 CAT
Treatment groups
Control 1.00 ± 0.053a 1.00 ± 0.021e 1.00 ± 0.018a Low chronic dose 0.87 ± 0.043b 3.27 ± 0.45d 0.79 ± 0.06b
High chronic dose 0.74 ± 0.044c 5.89 ± 0.179c 0.61 ± 0.047c Low subacute dose 0.39 ± 0.074d 10.44 ± 0.664b 0.27 ± 0.048d
High subacute dose 0.24 ± 0.060e 15.97 ± 0.671a 0.069 ± 0.022e
Means within the same column with different superscripts are significantly different (p<0.05)
Data illustrated in Table (5) and Fig. (18) identified the impact of thiamethoxam insecticide on growth related (ghrelin), immunity (TLR2) and stress (CAT) genes expression in liver of Nile tilapia. Statistically, there were significant differences detected in the expression of the three genes between all thiamethoxam treated groups and the control one. In addition, the lowest significance regarding ghrelin and catalase (CAT) expression was observed at the high subacute dose, while the lowest one regarding toll like receptors 2 (TLR2) genes was at the low chronic dose. Moreover, there was a significant upregulation in TLR2 gene expression while that of both ghrelin and CAT was significantly down regulated. The demonstrated findings revealed that fold change mean value for growth related genes (ghrelin) decreased by increasing dose of thiamethoxam as the 3weeks low chronic dose (25mg/l) decreased its mean value to be nearly 0.87 while at the high chronic dose (50mg/l) was 0.74. On the other hand, in 96h treatment with higher doses of THX, ghrelin gene expression mean value dramatically decreased to be 0.39 at the low subacute dose (100mg/l) and 0.24 at the high subacute one (250mg/l). In contrast, results for fold change mean value of immunity genes (TLR2) showed a marked elevation with increasing thiamethoxam dose. Consequently, after 3weeks of thiamethoxam use, it was nearly 3.27 at the low chronic dose (25mg/l) and 5.89 at the high chronic dose (50mg/l). In spite of this, it was almost doubled (10.44) in the 96h low subacute dose (100mg/l) and reached 15.97 in the high subacute dose (250mg/l). Lastly, the genetic expression of oxidative stress gene (CAT) showed a dramatic decrease with elevating thiamethoxam concentrations. So, the fold change mean value for CAT was about 0.79 at the low chronic dose (25mg/l) where as it was 0.61 (50mg/l) at the high chronic dose after 3weeks experimental period. Moreover, these values continued to decrease to become almost 0.27 at the low subacute dose (100mg/l) and 0.069 in the high subacute (250mg/l) one in 96h experimental trial.
6 ∆CT and ∆∆CT of ghrelin gene
∆CT GHRELIN ∆∆CT GHRELIN Fold change
1 1.55 -0.02333333 1.016304932
1 1.51 -0.06333333 1.044877153
1 1.66 0.08666667 0.941696017
2 1.72 0.14666667 0.903335201
2 1.86 0.28666667 0.819793998
2 1.75 0.17666667 0.884744831
3 2.04 0.46666667 0.723634619
3 1.9 0.32666667 0.797376688
3 2.05 0.47666667 0.718636109
4 3.24 1.66666667 0.314980262
4 2.81 1.23666667 0.424351986
4 2.7 1.12666667 0.457972645
5 3.37 1.79666667 0.28783887
5 3.44 1.86666667 0.274206245
5 4.07 2.49666667 0.177185608
AV CONT 1.5733333
7 ∆CT and ∆∆CT of TLR2 gene
Column1 ∆CT TLR2 ∆∆CT TLR2 Fold change
1 1.14 0 1
1 1.11 -0.03 1.021012126
1 1.17 0.03 0.979420298
2 -0.32 -1.46 2.751083636
2 -0.71 -1.85 3.60500185
2 -0.65 -1.79 3.458148925
3 -1.39 -2.53 5.775716782
3 -1.4 -2.54 5.815890069
3 -1.47 -2.61 6.105036836
4 -2.32 -3.46 11.00433455
4 -2.14 -3.28 9.713559075
4 -2.27 -3.41 10.62948651
5 -2.91 -4.05 16.56423878
5 -2.79 -3.93 15.24220797
5 -2.87 -4.01 16.1112888
AV CONT 1.14
8 ∆CT and ∆∆CT of CAT gene
Column1 ∆CT CAT ∆∆CT CAT Fold change
1 2.6 -0.01 1.00695555
1 2.59 -0.02 1.01395948
1 2.64 0.03 0.979420298
2 2.91 0.3 0.812252396
2 3.07 0.46 0.726986259
2 2.86 0.25 0.840896415
3 3.27 0.66 0.632878297
3 3.46 0.85 0.554784736
3 3.25 0.64 0.641712949
4 4.44 1.83 0.281264621
4 4.79 2.18 0.220675749
4 4.27 1.66 0.316439148
5 6.98 4.37 0.048361406
5 6.48 3.87 0.068393356
5 6.04 3.43 0.092782723
AV CONT 2.61
Fig. (17): Impact of thiamethoxam insecticide on growth related, immunity and stress genes expression in liver of Nile tilapia
Fig. (18): Plot amplification for ghrelin gene
Fig. (19): Plot amplification for TLR2 gene
Fig. (20): Plot amplification for CAT gene
7. Thiamethoxam residues concentrations in fish flesh:
Table (9): Thiamethoxam residue in Nile tilapia muscles reared under different levels
Treatment groups Thiamethoxam residue mg/kg
Control 0.090 ± 0.001d
Low chronic dose 3.233 ± 0.305c
High chronic dose 3.366 ± 0.208bc
Low subacute dose 3.833 ± 0.351b
High subacute dose 19.766 ± 0.450a
Means within the same column with different superscripts are significantly different (p<0.05)
Data represented in Table (9) and Fig. (21) showed thiamethoxam residues in Nile tilapia muscles reared under different levels. Statistically, there were significant differences in thiamethoxam residues between various treatment groups and control group with highest significance detected at the high subacute dose. Moreover, thiamethoxam residues were obviously detected at the control group (0.090 mg/kg), with its value increased with increasing thiamethoxam treatment dose. As they were nearly 3.233 mg/kg after 3 weeks treatment with low chronic dose (25 mg/l) and it increased slightly (3.366 mg/kg) at the high chronic dose (50 mg/l). In addition, a slight rise observed (3.833mg/kg) in the residues after 96h low subacute dose (100 mg/l), whereas the residues level markedly increased at the high subacute dose (250 mg/l) to reach nearly 19.77 mg/kg.
Fig. (21): Thiamethoxam residues in Nile tilapia muscles reared under different levels
8. Thiamethoxam effect on mortalities:
Table (10): Impact of thiamethoxam insecticide on survival of Nile tilapia
Treatment groups Mortality
Control 0 ± 0b
Low chronic dose 0.66 ± 1.15ab
High chronic dose 1.00 ± 1.00ab
Low subacute dose 1.33 ± 0.57ab
High subacute dose 2.00 ± 0a
Means within the same column with different superscripts are significantly different (p<0.05)
Data displayed in Table (10) and Fig. (22) clarified the impact of thiamethoxam insecticide on survival of Nile tilapia. Statistically, there were no significant differences in mortalities between various treatment groups and the control group with exception to high subacute dose that showed the highest significance of all groups. In fact, mortalities were increased with increasing doe thiamethoxam dose, as no mortalities observed in the control group while during the 3weeks treatment, some individual mortalities were observed firstly at the low chronic dose (25 mg/l) and recorded to be nearly 0.66 as a mean value for mortalities where as in the high chronic dose (50 mg/l) it reached 1. On the other hand, during the use of 96h subacute treatments, mean values of mortalities elevated to be 1.33 in low subacute (100 mg/l), whereas it was 2 in high subacute dose (250 mg/l) which was the highest recorded value of all treatments.
Fig. (22): Impact of thiamethoxam insecticide on survival of Nile tilapia fish
5. Discussion
The persistent chemicals of pesticides produced from agricultural practices, urban use, and pesticide producing plants are the cause of pesticide contamination in water. The main users of pesticides are farmers, who heavily apply pesticides to protect and enhance their agricultural production. Depending on the pesticide’s specific qualities, Chemical components from the pesticide that was applied to the preserved material could be released into the environment, contributing to pesticide contamination in surface waterways. Compared to other pesticides like fungicides and herbicides, the insecticide is more frequently found in urban areas (Abd El Megid et al., 2020).
1. Water quality parameters:
Water quality parameters are important in fish survival and growth and any pollutant affect them may adversely harm aquatic organisms indirectly. Data exhibited in Table (1) and Fig. (1) illustrates some water parameters after using different levels of thiamethoxam insecticide. Statistically, in pH, dissolved oxygen levels (DO), oxygen saturation percentage (DO%) and salinity, there were significant differences between different thiamethoxam treated groups and the control group, where the lowest significance observed regarding the pH, DO and DO% was at the high subacute dose while in salinity it was at the high chronic dose with the highest significance at the high subacute dose. Furthermore, PH, DO and DO% values decreased with increasing thiamethoxam concentration in water. However, thiamethoxam treatment increased the salinity of water. The decreased DO% and DO may be attributed to the increased uptake of DO as a result of abnormal metabolic activity caused by stress response induced by thiamethoxam toxicity.
Our results showed an agreement with Perschbacher and Ludwig (2004) who concluded that Diuron pesticide significantly decreased water quality parameters related to the dose, oxygen levels were lowered dangerously after ten days in the high drift and direct treatments, and almost reached the control levels after nearly 3 weeks. Moreover, in the high drift and direct treatments, pH value was lowered concomitant with the chlorophyll a decrease. Also with HASAN et al. (2021) who found that dissolved oxygen markedly lowered with rising thiamethoxam concentration and duration in water whereas no detected variations were observed for pH and temperature, when applying thiamethoxam at concentrations (9.37, 18.75, 37.5, 75 and 150 mg/L) for 60 days.
Besides Huang et al. (2023) showed that Diflubenzuron had a negative impact on pH and DO levels when applied at 0, 0.74, 2.222, 6.667, 20, and 60 μg /l . However, they supposed that the decrease in pH and DO was caused by the decline in photosynthesis process. In contrast, Lobson et al. (2018) disagreed with our results and detected that there were no significant difference in water quality parameters before and after thiamethoxam application. Moreover, Oghale et al. (2021) mentioned that water quality parameter showed no significant difference between the control and dimethoate treated groups with regard to pH, dissolve oxygen, temperature, electrical conductivity, total alkalinity and total dissolve solid (TDS).
2. Growth rate and weight gain of Nile tilapia:
Fish growth is considered one of the most important biomarkers for fish toxicity. The presented data in Table (2) and Fig. (2) showed the effect of thiamethoxam insecticide on growth rate of Nile tilapia. Statistically, there was a significant difference in final weight and weight gain of all treatments when compared with the control group. In addition, the lowest significance in the final weight and weight gain was observed at the high chronic dose while there was no significant change between both subacute doses.
It was recorded that the final weight decreased with increasing the chronic dose of thiamethoxam when compared with control group, with no observed impact in case of the 96h subacute treatment. The decreased growth and weight gain in fish in our study may be resulted from abnormal metabolism resulted from the stress response caused toxicity of thiamethoxam and decreased feed intake also decreased genetic expression of growth related hormones (ghrelin hormone) as we previously measured. Also, our findings were agreed by Dawood et al. (2020) who demonstrated a marked reduction in Nile tilapia weight gain, specific growth rate, final body weights and survival rate when exposed to a subacute dose of deltamethrin (15 μg/L) for 30days. Also Abdel-Tawwab et al. (2021) showed an agreement with our results as they pointed out a significant decrease in growth parameters of imidacloprid intoxicated Nile tilapia when compared to untreated group as a consequence of 8weeks exposure to 0.0 or 0.05 μg /L imidacloprid (IMI).
In addition, the reduced growth rates and final weights may be attributed to metabolic alterations caused by stress resulted from insecticides toxicity as the energy reserves was consumed by the intoxicated organism to counteract the harmful impact of the toxic substance or to activate its repairing mechanism resulting in impairing the metabolism of protein and carbohydrates. In conclusion, the energy required for growth was decreased (Khalil et al., 2017).
On the other hand, Zhu et al. (2019) disagreed with our results as he found that there was a significant reduction in body length of male Chinese rare minnow when applying thiamethoxam at 50 μg/L (p < 0.05), whereas, weight and hepatosomatic somatic index
(HSI) were significantly increased at 0.5 μg/L (p < 0.05) compared with the control condition.
In contrast, in females, the body length was markedly decreased in all treatment groups compared with the control group (p < 0.05), while there were no significant variations in other parameters, including weight and HSI. Similarly, RANIA and
NEDJOUA (2023) observed that there wasn’t any significant variation in growth of fresh water fish Alburnus alburnus fries exposed to thiamethoxam.
3. Impact of thiamethoxam on biochemical indices in Nile tilapia:
Serum biochemical indices have a key importance in detection of illnesses and toxicity in fish as they are indicators of the damage of various organs in the body of fish.
The observed data in Table (3) and Fig. (3) revealed the effect of thiamethoxam on serum proteins, Statistically, there was no significant change between different treatments and the control one. It was estimated that serum protein increased with increasing thiamethoxam concentration when compared to the control one (4.39 g/dl). Eventually, our results run parallel with Mukherjee et al. (2022) that observed a significant rise of serum protein in fresh water fish Clarias batrachus as compared to the un intoxicated group when exposed to the sublethal doses (6.93, 13.86 mg L−1) of thiamethoxam. As well Prakash (2020) supported ours by finding an elevation in Serum protein in Chlorpyrifos exposed Heteropnetues fossilis (Bloch) after exposure for 96 hours. In brief, the elevated serum protein content in fish may be attributed to the synthesis of important enzymes needed to detoxify toxic agents when they are stressed. It is also a general adaptive mechanism performed under toxicant stress (Bharti & Rasool, 2021).
However, results illustrated by Veedu et al. (2022) disagreed with ours as they detected a reduction in plasma protein levels as a result of use individual and binary mixtures of acetamiprid and thiamethoxam treatments in the freshwater fish Catla catla. In the same vein, Américo-Pinheiro et al. (2019) observed a marked reduction of total proteins in Nile tilapia exposed to imidacloprid.
Similarly, data illustrated in Table (3) and Fig. (4) demonstrated the effect of thiamethoxam insecticide on serum albumin (SA). Statistically, thiamethoxam had no significant change on SA at different treatments as well there was no difference between them and the control group. Additionally, results showed a raise in albumin concentrations as the concentrations of thiamethoxam increased as compared with untreated group.
Clearly, our results were supported by Fathy et al. (2019) who concluded that when exposing Nile tilapia to different herbicides, they induced a significant increase in levels of cholesterol, albumin, globulin, albumin/globulin (A/G) ratio.
Moreover, Sharafeldin et al. (2015) pointed out a marked increase in albumin and A/G ratio in Nile tilapia intoxicated with Profenofos insecticide, in addition they supposed that elevated serum albumin was caused by Impairment of kidney functions which were estimated that might resulted in albumin level imbalance and failure of stressed albumin excretion.
In contrast, Ilahi et al. (2018) results disagreed with ours as they found a marked decrease in serum albumin level of imidacloprid exposed groups of grass carp and golden fish when they were subjected to 2 ppm concentration for 28 and 24 days. Additionally, Kumar et al. (2010) demonstrated a negative impact of thiamethoxam insecticide on serum albumin in the fresh water fish Channa punctuates.
Additionally, data exhibited in Table (3) and Fig. (5) revealed the effect of thiamethoxam on serum globulin (SG) in Nile tilapia. Statistically, thiamethoxam did not cause a significant difference between the control group and both chronic and subacute treatments. While there was a significant difference in SG level between both chronic and subacute doses with the lowest significance observed in the low subacute treatment. Moreover, there was an observed elevation in globulin level with increasing thiamethoxam doses in chronic treatments while it decreased in 96h subacute dose.
Obviously, Our results showed an agreement with Raibeemol and Chitra (2018) who demonstrated a dramatic increase in protein and globulin levels in the freshwater fish, Pseudetroplus maculatus subjected to chlorpyrifos at two sublethal concentrations (0.661 µg/L, 1.32 µg/L) for 15 and 30 days. Moreover, Mukherjee et al. (2022) supported our findings as they found that Clarias batrachus experienced an elevation in globulin levels when fish exposed to sublethal (6.93, 13.86 mg L−1) and chronic (6.93, 13.86 mg L−1) doses of thiamethoxam insecticide. This elevation in serum globulin level was resulted from alterations in fish immunity (Gopal et al., 1997).
In contrast, El-bouhy et al. (2023) disagreed with our results as they detected a marked decrease in globulin concentrations in Grass carp exposed to 21days 1.8 µg/ L and
3.6 µg/ L of Profenofos. Additionally, Ilahi et al. (2018) found that serum globulin level was reduced in both grass carp and golden fish subjected to 2 ppm of imidacloprid for 28 and 24 days.
Generally, albumin is required for transportation of organic substances inside the body and is synthesized from liver while globulin is needed for immunity and synthesized from various organs. Our possible explanation for the elevated serum albumin in our study may be attributed to its antioxidant effect (non-enzymatic antioxidant) as it protects against tissue damage induced by thiamethoxam toxicity also it may be due to poor nutritional state induced by stress on fish. Also, elevated serum globulin may be due to immune response induced by fish body to overcome the damaging action of thiamethoxam on different organs (inflammatory response). Lastly, as a result of the elevation in both albumin and globulin, protein levels also increased as it consists of both of them. Moreover, the same trend of increasing serum proteins, albumin and globulin was observed in male albino rats treated with mixture of Imidacloprid and Fipronil pesticides at different concentrations for 28days (Badawy et al., 2018).
Regarding Table (3) and Fig. (6), data showed the effect of thiamethoxam insecticide on creatinine concentration in Nile tilapia. Statistically, there was a significant difference between high chronic dose and high subacute dose as compared to the control group, in addition the highest significant regarding creatinine level was observed at the high subacute dose while the lowest significant was at the low subacute one. Moreover, our results reported that creatinine levels increased as thiamethoxam concentrations increased with a slight decrease in the 96h low subacute dose when compared to the untreated group (0.88mg/dl).
These current results agreed with El Euony et al. (2020) findings in which they detected a dramatic elevation in serum creatinine level in African catfish subjected to 5 mg /l thiamethoxam for one month. Similarly, AbdelTawwab et al. (2021) found that Nile Tilapia experienced an exceptional elevation of serum creatinine 0.05 μg/L imidacloprid.
Interestingly, Amin and Hashem (2012) explained that the elevation in serum creatinine might be caused by glomerular disorders or increased breakdown of renal tissue, or decreased clearance by urine through the kidney. However, bentazon and halosulfuronmethyl herbicides resulted in non-significant decrease in creatinine level in Nile tilapia when exposed to sub-lethal concentrations of these herbicides for 96h as supposed by Fathy et al. (2019).
The data announced in Table (3) and Fig. (7) showed the effect of thiamethoxam insecticide on urea level in Nile tilapia. Statistically, there were no significant differences between the control group and subacute doses while there was a high significance observed at the high chronic dose compared to other treatments. Furthermore, thiamethoxam resulted in increased urea level in both chronic doses while it decreased urea concentrations in both subacute doses. However, increased urea levels in chronic doses use runs parallel to Bharti and Rasool (2021), as they detected an elevated levels of urea in Channa punctatus after exposure to malathion for 12days as a consequence of renal dysfunction. As well, it was detected in the fresh water fish Labeo rohita which experienced an increased urea levels when subjected to thiamethoxam insecticide at 0, 0.5, 1.0, 1.5, and 2.0 mg/L for 120h (Hussain et al., 2022).
A possible explanation to increased urea levels was clarified by Temiz and Kargın (2023) that elevated urea levels in fish serum was resulted from kidney failure. In contrast, the decreased urea levels in subacute doses was supported by Khan et al. (2019) who detected a significant reduction (P < 0.05) in urea levels in common carp after exposure to sub-lethal doses of endosulfan (0, 1, 3, 5 and 7 ppb) for 96h.
In the same vein, Taheri Mirghaed et al. (2018) observed a reduced serum urea levels in Cyprinus carpio intoxicated by 3 mg/L indoxacarb after 21 days. It was supposed that the reduced serum urea was attributed to decreased protein catabolism as plasma urea is an indicator of protein metabolism (Stoskopf, 1993; Yousefi et al., 2016).
Creatinine and urea are both considered as byproducts of protein metabolism. Creatinine is produced from creatine metabolism in muscle tissues. Both of them are filtered in urine through kidney. So elevation of both urea and creatinine may be as a result of renal failure caused by thiamethoxam toxicity. Also urea elevation may be resulted from gills dysfunction as fish gill is considered as a main route of its excretion. Moreover, decreased urea also in our results could be due to decreased liver synthesis of urea due to its severe damage or as a result of inadequate protein intake from the poor nutrition or may be from decreased protein metabolism.
The illustrated data in Table (3) and Fig. (8) has highlighted the effect of thiamethoxam insecticide on glucose level in Nile tilapia. Statistically, no significant differences were detected between all the treated groups and the control group as well. However, Serum glucose level was found to be increased with raising thiamethoxam concentration. In our study, glucose in general is considered one of the biomarkers for stress conditions in fish. Moreover, this increase in glucose level may be as a result of increased glycogenolysis and gluconeogensis caused by increased hormonal activities as a result of stress induced by thiamethoxam toxicity in fish. However, this increased glucose trend was also found in Clarias batrachus intoxicated by 1.65 mg/l chlorpyrifos (CPF) and 2.14 mg/l monocrotophos (MCP) for 3, 6, 9,12 and 15 days (Narra et al., 2017).
Similarly, Veedu et al. (2022) found an increased serum glucose level in Catla catla fish subjected to various concentrations of acetamiprid (0.5 mg/L and 1 mg/L), thiamethoxam (0.01 mg/L and 0.5 mg/L) and a mixture of them both (0.5 mg/L of acetamiprid and 0.01 mg/L of thiamethoxam) for 96 h.
Obviously, Fırat et al. (2011) possibly explained that, elevated glucose level is a sign of carbohydrate metabolism disruption, Perhaps as a result of enhanced liver glucose 6phosphatase activity, increased liver glycogen breakdown, or glucose synthesis from extrahepatic tissue proteins and amino acids. On the other hand, El-bouhy et al. (2023) results showed a marked elimination of serum glucose in Grass carp treated with 1.8 μg/ L and 3.6 μg/ L Profenofos for 21days. Furthermore, Mutlu et al. (2015) found a reduced glucose level in Nile tilapia exposed to 1.5 mg/L copper sulfate for 35, 65 and 95 days.
The data presented in Table (3) and Fig. (9) represented the effect of thiamethoxam insecticide on alanine transaminase (ALT) level in Nile tilapia. Statistically, there were no differences in ALT level between all treatment doses and the control group except for the high chronic dose, besides it showed the highest significance of all treatments. However, thiamethoxam intoxication resulted in raising of both ALT and AST levels with no detected change in ALT level in 96h subacute doses while AST level slightly decreased in low chronic dose.
It is well-known that ALT enzyme is found in liver and involved in converting protein into energy for liver cells whereas AST is produced from cells of liver, heart, skeletal muscles, kidney, pancreas and brain, it is involved in body breakdown of amino acids. Elevating both enzymes in our findings could be attributed to their leakage from liver cells into blood stream as a result of cells breakdown may be as a result of free radicals produced from thiamethoxam toxicity. Our results run parallel with Desai and Parikh
(2013) results as they demonstrated an increased levels of ALT and AST enzymes in Oreochromis mossambicus and Labeo rohita treated with sublethal doses (LC50/10 and LC50/20) of imidacloprid for 21 days.
In addition, Nile tilapia subjected to 0.05 μg/L imidacloprid has experienced a marked elevation in ALT and AST enzymes levels (AbdelTawwab et al., 2021). Moreover, Plasma ALT, AST increased in Nile tilapia subjected to 10.0 ppb chlorpyrifos
(CPF), Abamectin (ABM) and Emamectin benzoate (EB) for 48 and 96 h (Fırat & Tutus, 2020).
Additionally, Borges et al. (2007) suggested that ALT and AST are considered to be indicator enzymes for liver health. So, the activities of both enzymes when increased in the serum of fish, it may be related to liver necrosis and hepatocellular dysfunction. In contrast, El-bouhy et al. (2023) found decreased levels of AST and ALT enzymes in Grass carp intoxicated by 1.8 μg/ L and 3.6 μg/ L Profenofos for 21days. As well, Sapana Devi and Gupta (2014) exposed Anabas testudineus to deltamethrin and permethrin at sublethal concentrations of 0.007 and 0.0007 mg L−1, and 0.093 and 0.0093 mg L− for 21days and they found a dramatic decrease in AST level in liver and muscle tissues and ALT in muscle tissue of deltamethrin treated fish only.
The represented data in Table (3) and Fig. (11) revealed the effect of thiamethoxam insecticide on cholesterol level in Nile tilapia. Statistically, no significant differences observed between the treatments groups also between them and the control group. On the other hand, serum cholesterol expressed an increase in its level only in 3weeks chronic doses while it decreased in the 96h subacute doses when compared to control group.
The trend of elevating cholesterol level runs parallel with Hussain et al. (2022) as he found an elevated cholesterol level in Labeo rohita intoxicated with thiamethoxam insecticide at 0, 0.5, 1.0, 1.5, and 2.0 mg/L for 120h. Additionally, juvenile catfish treated with dimethoate at sub-lethal concentrations (0.01, 0.15and 0.29 mg/l) for 28 days experienced increased cholesterol levels at the lower exposure concentration. Possibly, The impairment in cholesterol level resulted from serious Lipid metabolism impairment in fishes caused by insecticide exposure (Oghale et al., 2021).
However, reduced levels of cholesterol in our results was also observed by Remia et al. (2008) as they treated Tilapia mossambica fish with a median lethal concentration of Monocrotophos insecticide for 24, 48, 72 and 96hours. Similarly, catfish (Clarias lazera) exposed to deltamethrin (DM) at 0.5 ug/L, for one week, and 0.02, and 0.01 ug/L for 4 weeks, experienced a marked decrease in serum total cholesterol and serum total lipids (TL) level after one week exposure to the concentration 0.5 ug/L of DM (Aziz et al., 2009).
According to Ganeshwade (2012) Cholesterol content was decreased during pesticides exposure in ovaries and liver when measured might be as a result of general damage, blockage of enzyme system for Steroidogenesis in ovary and the capacity of liver to store Cholesterol due general damage.
The demonstrated data in Table (3) and Fig. (12) explained the effect of thiamethoxam on triacylglycerol (TAG) level in Nile tilapia. Statistically, there were no significant differences between various treatment groups and the control one with exception to the low subacute dose that had the lowest significant change of all treatments. Furthermore, thiamethoxam intoxication resulted in decreased TAG levels when compared to control group with exception to the high chronic dose that resulted in a little increase of TAG level with no detected change in high subacute dose. The decreased level of TAG was also found in Clarias lazera exposed to deltamethrin (DM) at 0.02 ug/L for 4weeks (Aziz et al., 2009).
Furthermore, Osuna-Flores et al. (2019) detected that exposing the white shrimp
Litopenaeus vannamei for 7days to 0.0015 mg l−1 chlorpyrifos, 1.207 mg l−1 methamidophos, 0.0101 mg l−1 azinphos-methyl and 0.0075 mg l−1 methyl parathion has led to reduced triglycerides levels.
In addition, Logaswamy and Remia (2009) observed a marked decrease in triglycerides levels in Tilapia mossambica treated with median lethal dose of cypermetherin and Ekalux for 24h. However, the increased level of TAG observed in our results was also found in freshwater fish Labeo rohita intoxicated by thiamethoxam at sublethal doses (0, 0.5, 1.0, 1.5, and 2.0 mg/L) for 120h as found by Hussain et al. (2022).
Obviously, Ismail and Mahboub (2016) supposed that the rise in serum triglyceride levels may be attributed to the increased utilization of triglycerides. This phenomenon may occur to fulfill the energy requirements necessary for a plethora of causes like overcoming the damage inflicted by the xenobiotic, physical activity, biotransformation and finally elimination of the xenobiotic etc. In addition, Clarias batrachus subjected to 1.65 mg L_1 chlorpyrifos (CPF) and 2.14 mg L_1 monocrotophos (MCP) for various durations 3, 6, 9,12 and 15 days exhibited an elevated triglycerides levels (Narra et al., 2017).
The exhibited data in Table (3) and Fig. (13) clarified the effect of thiamethoxam insecticide on very low density lipoproteins (VLDL) level in Nile tilapia. Statistically, there were significant differences between various treatment groups and the control group except for both low chronic dose and high chronic dose that showed no significant changes with the lowest significance observed at the high chronic dose. However, VLDL level increased with increasing thiamethoxam dose except for the 96h low subacute dose.
This currently increased level of VLDL in our results was also detected by Saqer et al. (2019) in males of white mice subjected to Imidacloprid (IMI) at different doses (0, 2.8, 5.4 and 10) ppm for 30days. As well Hemat K. Mahmoud et al. (2022) detected an enhancement in VLDL levels in Nile tilapia treated with sub-lethal dose of fipronil (4.2 µg L−1 for 3 h only per day) for 8 weeks. On the other hand, VLDL levels was found to be decreased in common carp exposed to low (0.15 mg/L, 0.3 mg/L, 0.6 mg/L) of phosalone pesticide for 14 days (Kaya et al., 2015). It was possibly explained that the increased total cholesterol, TGs, LDL, and VLDL in the insecticide intoxicated fish can be caused by the detrimental effect of these pesticides on the liver’s lipid metabolism, which raises the blood lipid levels as a result (Yousef et al., 2003; Öner et al., 2008).
The represented data in Table (3) and Fig. (14) explained the effect of thiamethoxam on high density lipoproteins (HDL) level in Nile tilapia. Statistically, there were no significant differences in HDL levels between treatment groups and control one except for the high subacute dose which had the highest significance and the high chronic dose which represented the lowest significance. Furthermore, thiamethoxam was found to decrease the HDL level by increasing the treatment dose as compared to the control group except for the 96h subacute dose that increased HDL level. The reduced HDL levels trend runs parallel with Esenowo et al. (2022) as they detected a significant decrease in HDL levels in Clarias gariepinus juveniles exposed to 5, 7, 9, 11 and 15 mgL-1 chlorfenapyr for 96 h.
However, Bal et al. (2010) clarified that the harmful effect of neonicotinoid pesticides in increasing the level of cholesterol due to oxidative stress, and cholesterol is the former precursor of the formation of steroids that are produced in the liver by HDL and low-density lipoprotein (LDL), also Duzguner and Erdogan (2012) reported that IMI had a negative effect against the liver due to oxidative stress on liver cell tissue, affecting HDL and LDL. On the other hand, Fırat et al. (2011) detected an elevation in HDL levels in
Oreochromis niloticus subjected to 0.05 μg/l cypermethrin (CYP) for 4 and 21days. Furthermore, Mokhbatly et al. (2020) found an increased level of HDL in African catfish intoxicated by 1.5 mg/L Chlorpyrifos (CPF) for 60days.
Regarding the data presented in Table (3) and Fig. (15), it illustrates the effect of thiamethoxam insecticide on low density lipoproteins (LDL) levels in Nile tilapia. Statistically, no significant differences observed in LDL levels between thiamethoxam treated groups and control group. Our Findings revealed that LDL levels increased in both low chronic and subacute dose while it decreased in both high chronic and subacute doses when related to the untreated group.
In our results, elevated LDL levels were also detected in Nile tilapia subjected to 1.5 mg/L copper sulfate for 35, 65 and 95 days (Mutlu et al., 2015). In the same vein, African catfish subjected to Chlorpyrifos (CPF) at 1.5 mg/L for 60days exhibited an increased LDL concentrations compared to control group (Mokhbatly et al., 2020). Additionally, Kojima et al. (2004) attribute the increased LDL levels to changes in gene expression of some hepatic enzymes like HMG-CoA reductase (hydroxyl-methylglutaryl- CoA), which would suppress LDL-receptor gene expression.
Cholesterol and TAG are types of body lipids, but cholesterol are formed in all body cells, help in formation of steroid hormones, maintains the health of nerve cell and enter in synthesis of vitamin D while TAG is involved in energy production inside the body. Increased cholesterol levels may be indicative of kidney and liver disorders also cholesterol level may increase as a result of stress response in synthesis of steroid hormones. Decreased both of them may be attributed to impairment in lipid metabolism and malnutrition induced from stress response. When cholesterol (fats) binds with protein it’s called lipoprotein. Increased HDL may be as a result of liver cells damaging also increased LDL and VLDL may be as a result of liver and kidney disorders. Decreased HDL maybe as a result of liver and intestinal disorders induced by oxidative damage due to thiamethoxam toxicity also as a result of inflammatory response.
4. Impact of thiamethoxam on oxidative stress biomarker:
The data exhibited in Table (4) and Fig. (16) clarified the effect of thiamethoxam insecticide on serum oxidative stress parameters in Nile tilapia. Statistically, there were no significant differences in super oxide dismutase (SOD) levels between thiamethoxam treated groups and the control group. Moreover, for malondialdehyde (MDA), no significant differences observed between the treated groups but there was significant difference between them and the control group. Furthermore, there were no significant differences in total antioxidant capacity (TAC) levels between thiamethoxam treated group and control group while the lowest significance observed was at the high subacute dose.
However, thiamethoxam treatment resulted in decreasing the SOD levels in relation to the control group which was 3.27U/ml. SOD is one of the important antioxidant enzymes and is considered the first line defense mechanism against free radicles as it converts superoxide radicals into hydrogen peroxide and molecular oxygen. Decreased SOD levels in our study may be attributed to depletion of the enzyme resulted from elevated ROS levels that induce cell damage. In contrast, THX treatment caused an elevation in MDA levels when compared to the control group (1.05mM/ml). MDA is produced from lipid peroxidation as a result of oxidative stress induced by pollutants exposure in fish, so elevated MDA levels in fish is a strong indication of oxidative damage of different body cells. Obviously, TAC levels decreased as THX treatment concentrations increased in relation to control group.
TAC measures the amount of antioxidants inside fish body and its decrease in our study may be indicative of elevated free radicals induced by thiamethoxam induced oxidative stress in fish and depletion of antioxidants that help in their prevention. Our results run parallel with Yan et al. (2016) as they detected a slight increase in MDA activity on days 21 and 28 in zebrafish exposed to 0.30, 1.25, and 5.00 mg/L thiamethoxam for 7, 14, 21 and 28days. On the other hand, Ensibi et al. (2012) exposed common carp to carbofuran at 0, 10, 50, or 100 µg L−1 for 4, 15, or 30 days and found that carbofuran decreased the MDA content in fish liver. Additionally, Nile tilapia exposed to 477.29 mg/L, 2.901 µg/L thiamethoxam and lambda cyhalothrin individually and in mixture for 7 and 15 days exhibited reduced levels of TAC (Kocamaz & Oruc, 2018).
In addition, Hamed and Osman (2017) demonstrated a dramatic enhancement in hepatic and renal MDA and SOD levels and marked decrease in TAC levels in African catfish exposed to 0.121 mg/L carbofuran (CF) for 4 weeks. Moreover, Günal et al. (2019) found a marked elevation in MDA levels with an observed reduction in SOD levels when exposing Nile tilapia to sublethal concentrations of imidacloprid insecticide (50 and 100 mg/l) for 24 and 96 h.
In contrast, El-Garawani et al. (2021) observed an elevation in the activities and gene expression of SOD in Nile Tilapia exposed to 8.75 ppm and 17.5 ppm of imididacloprid for 21days. According to Veedu et al. (2022), the decrease in Superoxide dismutase (SOD) level was an adaptive response of fish to the insecticides as SOD is the first line in cellular defense against reactive oxygen species. Additionally, Amin and Hashem (2012) mentioned that, MDA are produced by LPO and considered as indicators of oxidative stress, which results from the free radical damage to membrane components of cells. Furthermore, H. K. Mahmoud et al. (2021) pointed out that the inhibition observed in TAC could be attributed to the deficient defense against ROS and the resulted H2O2 accumulation.
5. Impact of thiamethoxam on the histopathology of both gills and liver tissues of Nile Tilapia:
Thiamethoxam toxicity has showed typical changes in both gills and liver tissues which resulted in alterations in the functions of both organs that has led to the abnormal biochemical and genotoxic changes which typically affected fish survival and growth.
5.1. Gill tissue pathological changes:
According to our results in photos from (1 to 13) which illustrated the changes that happened in gill tissues including lamellar lifting and congestion of branchial blood vessel, eosinophilic granular cells (EGCs) infiltration, lamellar telangiectasis, filamentous clubbing, unilateral fusion of secondary lamellae, hemorrhages and lamellar lifting. Our results run parallel with Günal et al. (2019) who found that gill tissue of Nile Tilapia exposed to 50 and 100 mg/l imidacloprid for 24 and 96h has revealed epithelial lifting, fusion of secondary lamellae, telangiectasia and hyperaemia.
Also, El-Garawani et al. (2022) detected severe histopathological changes in the gills of Nile Tilapia as they were edematous and suffered from hyperplasia, hemorrhage, and fusion of the secondary lamellae where fish exposed to 19.5 ppm Acetamiprid for 21days. Besides, Georgieva et al. (2014) supported our results by detecting that common carp gills after intoxication by 6.6, 10 and 20 mg/l thiamethoxam have shown lamellar lifting, edema, proliferation of the glandular cells and epithelium covering the gill filament, fusion and degenerative changes with Vasodilatation of the blood vessels.
5.2. Liver tissue histopathological changes:
Regarding our findings in photos from (14 to 24), typically thiamethoxam intoxication in Nile Tilapia has led to pathological changes in liver tissue with no detected change in the control group including congestion of central veins, diffuse hydropic degeneration of hepatocytes, activation in melanomacrophage centers (MMCs) and vacuolation of hepatocytes.
Our results were supported by El Euony et al. (2020) as they pointed out that liver tissue of African cat fish exposed to 5mg/l TMX for 1 month has suffered from vacuolation of hepatocytes that was of hydropic and fatty type with pyknotic and eccentric nuclei, hepatocellular necrosis with mononuclear cell infiltrations, and perivascular mononuclear cell infiltrations, hemorrhage, and MMCs activation. Moreover, Ansoar-Rodríguez et al. (2016) found that Nile Tilapia liver has revealed histopathological changes including hydropic degeneration with pyknotic nucleus, cytoplasmic vacuolations and loss of cell limits, when fish were subjected to imidacloprid at 250, 125 and 62.5 mg/l after 96h.
Similarly, Hasan et al. (2023) showed that liver tissue in Banded Gourami exposed to thiamethoxam (9.37, 18.75, 37.5, 75, and 150 mg/L) for 90 days, has shown histopathological changes ranging from acute cellular swelling and fatty changes to vacuolation, autolysis and necrosis.
6. Gene expression by RT-PCR:
Data illustrated in Table (5) and Fig. (18) identified the impact of thiamethoxam insecticide on growth related (ghrelin), immunity (TLR2) and stress (CAT) genes expression in liver of Nile tilapia. Statistically, there were significant differences detected in the expression of the three genes between all Thiamethoxam treated groups and the control one. In addition, the lowest significance regarding ghrelin and catalase (CAT) expression was observed at the high subacute dose, while the lowest one regarding toll like receptors 2 (TLR2) genes was at the low chronic dose. Moreover, there was a significant upregulation in TLR2 gene expression while that of both ghrelin and CAT was significantly down regulated.
The demonstrated findings revealed that fold change mean value for growth related genes (ghrelin) decreased by increasing the dose of thiamethoxam when compared to the untreated fish. Ghrelin hormone is involved in enhancement of appetite, induces release of growth hormone and has a role in regulation of insulin release. However, decreased ghrelin levels in our study could be attributed to the damage occurred in cells that are responsible for ghrelin production in the gut also may be as a result of gastroenteritis caused by thiamethoxam toxicity. In contrast, results for fold change mean value of immunity genes (TLR2) showed a marked elevation with increasing thiamethoxam dose compared to nonintoxicated group.
Elevated levels of TLR2 (innate immunity) genes may be as a result of adaptive response against the oxidative stress in fish caused by thiamethoxam toxicity. Lastly, the genetic expression of oxidative stress gene (CAT) showed a dramatic decrease with elevating thiamethoxam concentrations in water. CAT act on hydrogen peroxide produced by SOD and converts into water and oxygen so it’s considered one of the important enzymes involved in free radicals scavenging, the decreased CAT levels may be as a result of elevated levels of ROS that caused damage in liver cells so prevent them from cat synthesis also it may be resulted from an adaptive response of the body against stress induced by thiamethoxam toxicity.
The decreased expression of ghrelin gene trend was also found in Carassius auratus gibelio exposed to Cadmium (Cd) at 1, 2, and 4 mg/L for 30 days (Cai et al., 2020). Also they found that found that Cd exposure led to significant changes in the expression levels of neurohormone-related genes (gherlin) in the brain, which might also explain the observed changes in food intake and weight in the Cd-exposed fish.
Furthermore, Lal et al. (2013) found elimination in the levels of growth hormone (GH) and thyroxine (T4) in catfish when they are subjected to Malathion at 0.001 ml/liter and 0.0001 ml/liter. Our results disagreed with Marlatt et al. (2019) as they found no significant effect on expression of growth genes of embryonic, alevin and early swim-up fry sockeye salmon exposed to 0.15, 1.5, 15 and 150 μg/L clothianidin for 4months. However, the increased trend of gene expression of TLR2 runs parallel with Zhao et al. (2020) as they found an upregulation in transcriptional level of genes enter in Toll-like receptors (TLR) in grass carps spleen when fish exposed to 0.651 μg/L cypermethrin and 0.3 μg/L sulfamethoxazole for 42 days.
In addition, gene expression of Toll-like receptors (including TLR1 and TLR2) were dramatically upregulated in Chinese mitten crab exposed to 0 µg/L, 150 µg/L and 300 µg/L of thiamethoxam for 96h (Yang et al., 2023). On the other hand, Tang et al. (2021) supposed that crucian carp exposed to 300 μg/L diazinon for 21 days exhibited significant downregulation (P < 0.05) in gene expression of TLR4, MyD88, NF-kB p100 and IL-8 while there was no significant change in TNF-α. In their study, they concluded that 24h intoxication by thiamethoxam exceptionally upregulated the expression levels of TLR1, TLR2 suggesting that thiamethoxam exposure might induce inflammation in juvenile E.
sinensis via NF-κB signaling pathway.
Moreover, decreased catalase mRNA content was also supported by Tian et al. (2020) as they found a dramatic down regulation of catalase gene in juvenile Chinese rare minnows when exposed to exposed to 0.1, 0.5, or 2.0 mg/L imidacloprid, nitenpyram, and dinotefuran for 60 days.
Additionally, Ahmed et al. (2022) found a marked down regulation of the antioxidant enzymes (sod and cat) gene expression in Nile tilapia liver when fish exposed to 1.39mg/l atrazine. In contrary to this, El-Garawani et al. (2021) detected that mididacloprid intoxicated Nile tilapia exhibited an increase in the expression and activities of SOD, CAT in fish liver.
7. Thiamethoxam residues concentrations in fish flesh:
Data represented in Table (10) and Fig. (22) showed thiamethoxam residues in Nile tilapia muscles reared under different levels. Statistically, there were significant differences in thiamethoxam residues between various treatment groups and control group with highest significance detected at the high subacute dose. Moreover, thiamethoxam residues were obviously detected at the control group (0.090mg/kg), with its value increased with increasing thiamethoxam treatment dose.
Our results have showed an agreement with Abd El-hameed et al. (2021) who found increased residual imidacloprid (IMID) levels in Nile tilapia flesh and liver tissues after exposure to a sub-lethal dose of IMID (0.0109 μg/L) for two weeks. As well Zhang et al. (2023) supported our results by finding dramatic increase in TMX residual content in the muscle and Hepatopancreas of red swamp crayfish subjected to 10 ppt of thiamethoxam insecticide for 7days.
In our current results thiamethoxam residual content was also detected in the control group which indicates that most Egyptian farm use water may be contaminated by residues of insecticides and pesticides as the control group residual thiamethoxam exceeded the permissible levels for human consumption (0.01mg/kg) according to the Reference lab for Ministry of Agriculture Accredited according to ISO/IEC17025 by FINAS.
8. Thiamethoxam effect on mortalities:
Data displayed in Table (11) and Fig. (23) clarified the impact of thiamethoxam insecticide on survival of Nile tilapia. Statistically, there were no significant differences in mortalities between various treatment groups and the control group with exception to high subacute dose that showed the highest significance of all groups. In fact, mortalities were increased with increasing thiamethoxam dose, with no mortalities observed in the control group. Individual mortalities in our results may be caused by exhaustion of all adaptive mechanisms to overcome the stress induced by toxicity of thiamethoxam in fish.
Our results run parallel with Albinati et al. (2016) who found a direct relationship between mortalities rates of Nile tilapia fingerlings and increased thiamethoxam insecticide concentration when exposing fish to 150, 300, 450, 600 and 750mg / L Actara. Moreover, Sabra and Mehana (2015) mentioned that when is the launch of large quantities of pollutants there might be an immediate impact as measured by mortality the sudden largescale aquaculture, for example, fish kills caused by pollution of water ways with agricultural pesticides. Lower levels of discharge may result in accumulation of pollutants in aquatic organisms.
6. Summary
The present study was carried out in Fish Diseases Department, Animal Health Research Institute, Alexandria branch, Egypt to evaluate the effect of water pollution by thiamethoxam insecticide on health condition of Nile tilapia (Oreochromis niloticus). The used insecticide was Actara 25 WG manufactured by Sygenta, Egypt and it was purchased from Egyptian Company for Seeds and Agricultural Chemicals. It composed of 250 g/kg thiamethoxam, 3-(2chloro-thiazol-5-ylmethyl)-5-methyl-(1,3,5) oxadiazinan-4-yldene-Nnitroamine and 750 g/kg inert ingredients.
A total of 200 O. niloticus with an average initial weight of 15 ± 5 g have been obtained from a commercial fish farm in Kafr Elsheikh province, Egypt. They were placed upon arrival in 100 L glass aquaria provided with artificial aeration. Fish were kept for acclimatization for seven days in chlorine free water where they were given feed twice daily. Fish were given pelleted feed (30 % crude protein at a rate of 3% of fish body weight). A biweekly partial water exchange was applied with the help of siphoning tube that remove wastes and feed residues from all the aquariums and keep them clean as much as possible. After that, fish were randomly allotted to five replicated treatments. They were kept at a density of 10 fish / aquaria. Four different concentrations of the insecticide were tested with three replicates of fish for each treatment (25 mg/l, 50 mg/l, 100 mg/l and 250 mg /l) beside no insecticide in the control group.
The results regarding water quality parameters pH, dissolved oxygen levels (DO), oxygen saturation percentage (DO%) and salinity showed significant differences between different thiamethoxam treated groups and the control group, where the lowest significance observed regarding the pH, DO and DO% was at the high subacute dose while in salinity it was at the high chronic dose with the highest significance at the high subacute dose.
The study findings related to fish growth rate and weight gain revealed a significant difference statistically in final weight and weight gain of all treatments when compared with the control group. In addition, the lowest significance in the final weight and weight gain was observed at the high chronic dose while there was no significant change between both subacute doses.
Serum biochemical analysis results regarding to serum proteins analysis findings, there was no significant change between different treatments and the control one. It was estimated that serum protein increased with increasing thiamethoxam concentration when compared to the control one (4.39 g/dl). Similarly, for serum albumin (SA), thiamethoxam had no significant change on SA at different treatments as well there was no difference between them and the control group.
Concerning serum globulin (SG), thiamethoxam did not cause a significant difference between the control group and both chronic and subacute treatments. While there was a significant difference in SG level between both chronic and subacute doses with the lowest significance observed in the low subacute treatment. Additionally, thiamethoxam resulted in a significant difference in the mean value of serum creatinine between high chronic dose and high subacute dose as compared to the control group, in addition the highest significant regarding creatinine level was observed at the high subacute dose while the lowest significant was at the low subacute one. However, serum urea mean value has revealed no significant difference between the control group and subacute doses while there was a high significance observed at the high chronic dose compared to other treatments.
Regarding serum glucose level in Nile tilapia, statistically, no significant differences were detected between all the treated groups and the control group as well as a consequence of 3weeks thiamethoxam treatment, glucose level was observed to be increased with increasing the intoxication dose. In the same vein, thiamethoxam caused no significant differences in ALT levels between all treatment doses and the control group except for the high chronic dose, besides it showed the highest significance of all treatments. However, results of 3weeks treatment with thiamethoxam revealed an increase in ALT level by increasing the concentration of thiamethoxam.
Thiamethoxam insecticide impact on aspartate transaminase (AST) level in Nile tilapia caused no significant differences between the untreated group and other treated ones, however, there were a significant differences observed between both low chronic dose and high subacute dose than other treated groups with the lowest detected significance at the low chronic dose. Moreover, serum cholesterol levels in Nile tilapia exposed to thiamethoxam expressed no significant differences between the treatment groups also between them and the control group. On the other hand, thiamethoxam impact on serum triacylglycerol (TAG) levels in Nile tilapia have exhibited no significant differences between various treatment groups and the control one with exception to the low subacute dose that had the lowest significant change of all treatments.
For very low density lipoproteins (VLDL) level in Nile tilapia, there were significant differences between various treatment groups and the control group except for both low chronic dose and high chronic dose that showed no significant changes with the lowest significance observed at the high chronic dose. Furthermore, high density lipoproteins (HDL) level in Nile tilapia showed no significant differences in HDL levels between treatment groups and control one except for the high subacute dose which had the highest significance and the high chronic dose which represented the lowest significance. Lastly, thiamethoxam insecticide effect on low density lipoproteins (LDL) levels in Nile tilapia expressed no significant differences between thiamethoxam treated groups and control group.
For serum oxidative stress biomarkers, thiamethoxam adversely affected oxidative stress biomarkers in Nile tilapia. However, there were no significant differences in super oxide dismutase (SOD) levels between thiamethoxam treated groups and the control group. Moreover, for malondialdehyde (MDA), no significant differences observed between the treated groups but there was significant difference between them and the control group. Furthermore, there were no significant differences in total antioxidant capacity (TAC) levels between thiamethoxam treated group and control group while the lowest significance observed was at the high subacute dose.
Histopathological changes in both liver and gill tissues in Nile Tilapia revealed the toxic impact of thiamethoxam on fish as we found in our results that the control group expressed no pathological changes in both organs while for the exposed groups of fish gill tissues have revealed lamellar lifting and congestion of branchial blood vessel, eosinophilic granular cells (EGCs) infiltration, lamellar telangiectasis, filamentous clubbing, unilateral fusion of secondary lamellae, hemorrhages and lamellar lifting. Whereas liver tissues have shown congestion of central veins, diffuse hydropic degeneration of hepatocytes, activation in melanomacrophage centers (MMCs) and vacuolation of hepatocytes.
Concerning thiamethoxam insecticide impact on growth related (ghrelin), immunity (TLR2) and stress (CAT) genes expression in liver of Nile tilapia, there were significant differences detected in the expression of the three genes between all thiamethoxam treated groups and the control one. In addition, the lowest significance regarding ghrelin and catalase (CAT) expression was observed at the high subacute dose, while the lowest one regarding toll like receptors 2 (TLR2) genes was at the low chronic dose. Moreover, there was a significant upregulation in TLR2 gene expression while that of both ghrelin and CAT was significantly down regulated.
Thiamethoxam residues in Nile tilapia muscles reared under different levels were significantly different between various treatment groups and control group with highest significance detected at the high subacute dose. Moreover, thiamethoxam residues were obviously detected at the control group (0.090mg/kg), with its value increased with increasing thiamethoxam treatment dose.
Thiamethoxam resulted in absence of significant differences in mortalities between various treatment groups and the control group with exception to high subacute dose that showed the highest significance of all groups. In fact, mortalities were increased with increasing thiamethoxam dose, as no mortalities observed in the control group while during the 3 weeks treatment; some individual mortality was observed firstly at the low chronic dose (25mg/l) and recorded to be nearly 0.66 as a mean value for mortalities where as in the high chronic dose (50mg/l) it reached 1. On the other hand, during the use of 96h subacute treatments, mean values of mortalities elevated to be 1.33 in low subacute (100mg/l), whereas it was 2 in high subacute dose (250mg/l) which was the highest recorded value of all treatments.
Conclusion
7. Conclusion and Recommendations
It seems that thiamethoxam is considered one of the low toxicity neonicotinoid insecticides which made it very popular to be used as pesticide in many areas around the world, but unfortunately, results of our current study argued that it had harmful effects in aquatic non targeted organisms.
Our studies proved that as it has disturbed both serum biochemical and oxidative stress biomarkers in Nile tilapia which are very important in toxicity detection in fish. As a consequence, thiamethoxam affects liver, kidney, gills and heart integrity as well as it has negative impact on fish metabolic activity. Additionally, histopathological changes observed in both gills and liver supported these harmful effects. Moreover, our current study has proved that this insecticide has adverse impact on both survival and growth of Nile tilapia fish, as growth and survival of Nile tilapia was found to be decreased with elevating thiamethoxam dose. Furthermore, these adverse impacts were also found at molecular level when we detected changes in gene expression of some important genes (genes related to stress, growth and innate immunity) in liver tissues. Finally, we detected that it could affect human health by its accumulation in edible flesh in fish.
Some possible recommendations to be considered:
• Periodical analysis of water bodies for pesticides residues by using HPLC to detect if there is a leakage in water that can be very harmful and may lead to mass deaths in fish.
• Fish farms should avoid using water from agricultural drainage in fish farming or they can treat this water before use if there is a water shortage from a clean source.
• It is recommended to use of aquaponics system as this system depends on a symbiotic relationship between fish and plants where fish wastes fertilize plants and in turn plants filter and clean the water for fish (clean system with low costs).
• Hygienic disposal of pesticide wastes and empty containers by burial in areas as far away as possible from water bodies and underground water (in deserts may be).
Conclusion
• Hygienic disposal of sewage water and wastes produced from plants or factories away from water bodies.
• Avoid frequent irrigation of the cultivated lands as it increases their reaching to water bodies.
• It is preferable to use pesticides that are well-known for their low toxicity to nontargeted organisms and to follow the directions written on the package or label of the pesticides carefully before application to avoid their adverse impact as possible.
• Avoid using pesticides on crops during rainy or stormy days to prevent them from reaching water bodies with rain water by running off.
• Pesticides should be stored in a locked storage place with impervious floors that prevent any kind of leakage also workers should periodically inspect the containers for any damage that can lead to pesticides spill or leakage.
• It is important to make the farmers and agricultural lands owners aware about the dangers of water pollution by pesticides.
• It is suggested to use various analytical tests (different biochemical tests, immunohistochemistry, RT-PCR examination for a range of important genes that are related to fish growth and survival, histopathological examination of different organs with special referencing to nervous system).
• Finally, we recommend making further studies on other fresh or marine water fish species also with a wide range of different doses.
8. References
Abd El Megid, A., Abd Al Fatah, M.E., El Asely, A., El Senosi, Y., Moustafa, M.M., Dawood, M.A., (2020). Impact of pyrethroids and organochlorine pesticides residue on IGF-1 and CYP1A genes expression and muscle protein patterns of cultured Mugil capito. Ecotoxicology and environmental safety, 188, p.109876.
Abd El-hameed, S. A. A., Negm, S. S., Ismael, N. E. M., Naiel, M. A. E., Soliman, M. M., Shukry, M., & Abdel-Latif, H. M. R. (2021). Effects of Activated charcoal on Growth, Immunity, Oxidative Stress Markers, and Physiological Responses of Nile Tilapia Exposed to Sub-Lethal Imidacloprid Toxicity. Animals, 11(5).
Abdel Rahman, A. N., AbdelMageed, M. A., Assayed, M. E. M., Gharib, H. S. A.-R., Nasr, M. A., Elshopakey, G. E., . . . Ahmed, S. A. A. (2023). Imidacloprid induced growth, hematological, neuro-behavior, anti-oxidant, economic, genetic, and histopathological alterations in Clarias gariepinus: Alleviative role of dietary Hyphaene thebaica. Aquaculture, 564, 739058.
Abdel-Tawwab, M., El-Saadawy, H. A., El-Belbasi, H. I., Abd El-Hameed, S. A. A., & Attia, A. A. (2021). Dietary spirulina (Arthrospira platenesis) mitigated the adverse effects of imidacloprid insecticide on the growth performance, haematobiochemical, antioxidant, and immune responses of Nile tilapia. Comparative Biochemistry and Physiology Part C: Toxicology & Pharmacology, 247, 109067.
Afifi, M., Ali, H. A., Saber, T. M., & El-Murr, A. e. (2016). Lethrinas nebulosus fish as a biomarker for petroleum hydrocarbons pollution in Red Sea: Alterations in antioxidants mRNA expression. Japanese Journal of Veterinary Research, 64(Supplement 2), S123-S129.
Ahmed, M. M., Mohammed, A. T., Farag, M. R., Hassan, M. A., Mawed, S. A., Alagawany, M., . . . Abdel-Latif, H. M. R. (2022). Dietary Supplementation of Nile Tilapia (Oreochromis niloticus) With Panax ginseng Essential Oil: Positive Impact on Animal Health and Productive Performance, and Mitigating Effects on Atrazine- Induced Toxicity. Frontiers in Marine Science, 9.
Albinati, A. C. L., Albinati, R. C. B., Lira, A. D., & Soares, P. C. (2016). Toxicidade aguda e risco ecotoxicológico do inseticida tiametoxam para alevinos de tilápiado-nilo. Arquivo Brasileiro de Medicina Veterinária e Zootecnia, 68.
Albinati, A. C. L., Soares, P. C., Moreira, E. L. T., Albinati, R. C. B., da Silva, A. L.,
& de Medeiros, S. D. C. (2020). Parâmetros bioquímicos de tilápia do Nilo
exposta ao tiametoxam. Research, Society and Development, 9(11), e92391110475-e92391110475.
Allain, C. C., Poon, L. S., Chan, C. S. G., Richmond, W., & Fu, P. C. (1974). Enzymatic Determination of Total Serum Cholesterol. Clinical Chemistry, 20(4), 470-475.
Américo-Pinheiro, J. H. P., da Cruz, C., Aguiar, M. M., Torres, N. H., Ferreira, L. F. R., & Machado-Neto, J. G. (2019). Sublethal Effects of Imidacloprid in Hematological Parameters of Tilapia (Oreochromis niloticus). Water, Air, & Soil Pollution, 230(8), 193.
Amin, K. A., & Hashem, K. S. (2012). Deltamethrin-induced oxidative stress and biochemical changes in tissues and blood of catfish (Clarias gariepinus): antioxidant defense and role of alpha-tocopherol. BMC Veterinary Research, 8(1), 45.
Ansoar-Rodríguez, Y., christofoletti, C. A., Correia, J. E., de Souza, R. B., Moreirade-Sousa, C., Marcato, A. C. d. C., . . . Fontanetti, C. S. (2016). Liver alterations in Oreochromis niloticus (Pisces) induced by insecticide imidacloprid: Histopathology and heat shock protein in situ localization. Journal of Environmental Science and Health, Part B, 51(12), 881-887.
Aziz, M., Hegazi, H., Abd EL-Khalik, M., & Taha, M. (2009). Effect of deltamethrin on liver and kidney function of Clarias lazera fish. Kafrelsheikh Veterinary Medical Journal, 7(1), 206-232.
Badawy, M. H., Ahmed, N. S., & Attia, A. M. (2018). Sub-acute oral toxicity of imidacloprid and fipronil pesticide mixture in male albino rats; biochemical and reproductive toxicity evaluation. Journal of Materials and Environmental Sciences, 9(6), 2431-2437.
Bal, R., Erdogan, S., Theophilidis, G., Baydas, G., & Naziroglu, M. (2010). Assessing the effects of the neonicotinoid insecticide imidacloprid in the cholinergic synapses of the stellate cells of the mouse cochlear nucleus using whole-cell patch-clamp recording. NeuroToxicology, 31(1), 113-120.
Baldissera, M. D., Souza, C. F., Golombieski, J. I., Seben, D., Sippert, L. R., Salbego, J., . . . Baldisserotto, B. (2018a). Purinergic signaling as potential target of thiamethoxam-induced neurotoxicity using silver catfish (Rhamdia quelen) as experimental model. Molecular and Cellular Biochemistry, 449(1), 39-45.
Baldissera, M. D., Souza, C. F., Seben, D., Sippert, L. R., Salbego, J., Marchesan, E., . . . Golombieski, J. I. (2018b). Gill bioenergetics dysfunction and oxidative damage induced by thiamethoxam exposure as relevant toxicological mechanisms in freshwater silver catfish Rhamdia quelen. Science of the Total Environment, 636, 420-426.
Barbosa, M. O., Moreira, N. F. F., Ribeiro, A. R., Pereira, M. F. R., & Silva, A. M. T. (2016). Occurrence and removal of organic micropollutants: An overview of the watch list of EU Decision 2015/495. Water Research, 94, 257-279.
Bartels, H., Böhmer, M., & Heierli, C. (1972). Serum kreatininbestimmung ohne enteiweissen. Clinica Chimica Acta, 37, 193-197.
doi:https://doi.org/10.1016/0009-8981(72)90432-9
Bass, C., Denholm, I., Williamson, M. S., & Nauen, R. (2015). The global status of insect resistance to neonicotinoid insecticides. Pesticide Biochemistry and Physiology, 121, 78-87.
Béné, C., Macfadyen, G., & Allison, E. H. (2007). Increasing the contribution of smallscale fisheries to poverty alleviation and food security: Food & Agriculture Org.
Bharti, S., & Rasool, F. (2021). Analysis of the biochemical and histopathological impact of a mild dose of commercial malathion on Channa punctatus (Bloch) fish. Toxicology Reports, 8, 443-455.
Boonanuntanasarn, S., Jangprai, A., Kumkhong, S., Plagnes-Juan, E., Veron, V., Burel, C., . . . Panserat, S. (2018). Adaptation of Nile tilapia (Oreochromis niloticus) to different levels of dietary carbohydrates: New insights from a long term nutritional study. Aquaculture, 496, 58-65.
Borges, A., Scotti, L. V., Siqueira, D. R., Zanini, R., Amaral, F. d., Jurinitz, D. F., & Wassermann, G. F. (2007). Changes in hematological and serum biochemical values in jundiá Rhamdia quelen due to sub-lethal toxicity of cypermethrin. Chemosphere, 69(6), 920-926.
Borsuah, J. F., Messer, T. L., Snow, D. D., Comfort, S. D., & Mittelstet, A. R. (2020). Literature Review: Global Neonicotinoid Insecticide Occurrence in Aquatic Environments. Water, 12(12), 3388.
Bose, S., Nath, S., & Sahana, S. (2011). Toxic impact of thiamethoxam on the growth performance and liver protein concentration of a freshwater fish Oreochromis niloticus (Trewavas). Indian journal of fundamental and applied life sciences, 1(4), 274-280.
Bouelet Ntsama, I. S., Tambe, B. A., Tsafack Takadong, J. J., Medoua Nama, G., & Kansci, G. (2018). characteristics of fish farming practices and agrochemicals usage therein in four regions of Cameroon. The Egyptian Journal of Aquatic Research, 44(2), 145-153.
Boyd, C. E. (2017). Chapter 6 - General Relationship Between Water Quality and Aquaculture Performance in Ponds. In G. Jeney (Ed.), Fish Diseases (pp. 147166): Academic Press.
Cai, Y., Yin, Y., Li, Y., Guan, L., Zhang, P., Qin, Y., . . . Li, Y. (2020). Cadmium exposure affects growth performance, energy metabolism, and neuropeptide expression in Carassius auratus gibelio. Fish Physiology and Biochemistry, 46(1), 187-197.
Calitz, C., Hamman, J. H., Fey, S. J., Wrzesinski, K., & Gouws, C. (2018). Recent advances in three-dimensional cell culturing to assess liver function and dysfunction: from a drug biotransformation and toxicity perspective. Toxicology Mechanisms and Methods, 28(5), 369-385.
Campos-Garcia, J., Martinez, D. S. T., Alves, O. L., Leonardo, A. F. G., & Barbieri, E. (2015). Ecotoxicological effects of carbofuran and oxidised multiwalled carbon nanotubes on the freshwater fish Nile tilapia: Nanotubes enhance pesticide ecotoxicity. Ecotoxicology and Environmental Safety, 111, 131-137.
Casida, J. E. (2018). Neonicotinoids and Other Insect Nicotinic Receptor Competitive Modulators: Progress and Prospects. Annual Review of Entomology, 63(1), 125144.
Chagnon, M., Kreutzweiser, D., Mitchell, E. A. D., Morrissey, C. A., Noome, D. A., & Van der Sluijs, J. P. (2015). Risks of large-scale use of systemic insecticides to ecosystem functioning and services. Environmental Science and Pollution Research, 22(1), 119-134.
Chan, C.-B., & Cheng, C. H. K. (2004). Identification and functional characterization of two alternatively spliced growth hormone secretagogue receptor transcripts from the pituitary of black seabream Acanthopagrus schlegeli. Molecular and Cellular Endocrinology, 214(1), 81-95.
Dawood, M. A. O., AbdEl-kader, M. F., Moustafa, E. M., Gewaily, M. S., & Abdo, S. E. (2020). Growth performance and hemato-immunological responses of Nile tilapia (Oreochromis niloticus) exposed to deltamethrin and fed immunobiotics. Environmental Science and Pollution Research, 27(11), 11608-11617.
Desai, B., & Parikh, P. (2013). Biochemical alterations on exposure of imidacloprid and curzate on fresh water fish Oreochromis mossambicus and Labeo rohita. Indian Journal of Forensic Medicine & Toxicology, 7(2), 87.
Ding, T.-t., Zhang, Y.-h., Zhu, Y., Du, S.-l., Zhang, J., Cao, Y., . . . He, L.-s. (2019). Deriving water quality criteria for China for the organophosphorus pesticides dichlorvos and malathion. Environmental Science and Pollution Research, 26(33), 34622-34632.
Doumas B.T., Watson W.A. & Biggs H.G. (1971). Albumin standards and the measurement of serum albumin with bromocresol green. Clin Chim Acta, 31(1):87–96.
Duzguner, V., & Erdogan, S. (2012). chronic exposure to imidacloprid induces inflammation and oxidative stress in the liver & central nervous system of rats. Pesticide Biochemistry and Physiology, 104(1), 58-64.
El Euony, O. I., Elblehi, S. S., Abdel-Latif, H. M., Abdel-Daim, M. M., & El-Sayed, Y. S. (2020). Modulatory role of dietary Thymus vulgaris essential oil and Bacillus subtilis against thiamethoxam-induced hepatorenal damage, oxidative stress, and immunotoxicity in African catfish (Clarias garipenus). Environmental Science and Pollution Research, 27(18), 23108-23128.
El-bouhy, Z. M., Mohamed, F. A. S., Elashhab, M. W. A., & El-Houseiny, W. (2023). Toxicity bioassay and sub-lethal effects of profenofos-based insecticide on behavior, biochemical, hematological, and histopathological responses in Grass carp (Ctenopharyngodon idella). Ecotoxicology, 32(2), 196-210.
El-Garawani, I. M., Khallaf, E. A., Alne-na-ei, A. A., Elgendy, R. G., Mersal, G. A. M., & El-Seedi, H. R. (2021). The role of ascorbic acid combined exposure on Imidacloprid-induced oxidative stress and genotoxicity in Nile tilapia. Scientific Reports, 11(1), 14716.
El-Garawani, I. M., Khallaf, E. A., Alne-na-ei, A. A., Elgendy, R. G., Sobhy, H. M., Khairallah, A., . . . Nofal, A. E. (2022). The Effect of Neonicotinoids Exposure
on Oreochromis niloticus Histopathological Alterations and Genotoxicity. Bulletin of Environmental Contamination and Toxicology, 109(6), 1001-1009.
El-Sayed, A.-F. M. (2020). Chapter 12 - The role of tilapia culture in rural development. In A.-F. M. El-Sayed (Ed.), Tilapia Culture (Second Edition) (pp. 275-295): Academic Press.
El-Sayed, A.-F. M., & Fitzsimmons, K. (2023). from Africa to the world—The journey of Nile tilapia. Reviews in Aquaculture, 15, 6-21.
Ensibi, C., Moreno, D. H., Rodríguez, F. S., Yahya, M. N. D., Míguez-Santiyán, M. P., & Pérez-López, M. (2012). Effects of subchronic exposure to carbofuran on antioxidant defence system and malondialdehyde levels in common carp (Cyprinus carpio L.). Toxicological & Environmental Chemistry, 94(4), 748-759.
Eruola, A., Ufoegbune, G., Awomeso, J., & Abhulimen, S. (2011). Assessment of cadmium, lead and iron in hand dug wells of Ilaro and Aiyetoro, Ogun State, South-Western Nigeria. Research Journal of Chemical Sciences, 1(9), 1-5.
Esenowo, I., Nelson, A., Ekpo, N., Chukwu, M., Akpan, A., Ugwumba, A., . . . Udoidung, N. (2022). Effects of acute exposure to chlorfenapyr on hepatic enzyme activities and serum lipid profile of African catfish, Clarias gariepinus (Burchell 1822). World Journal of Applied Science & Technology, 14(1b), 86-93.
FAO. (2020). The State of World Fisheries and Aquaculture 2020. Sustainability in action. Rome, Italy: FAO.
Fathy, M., Mohamed, I. A., Farghal, A. I. A., Temerak, S. A. H., & Sayed, A. E.-D. H. (2019). Hemotoxic effects of some herbicides on juvenile of Nile tilapia Oreochromis niloticus. Environmental Science and Pollution Research, 26(30), 30857-30865.
Fawcett, J. K., & Scott, J. E. (1960). A rapid and precise method for the determination of urea. J Clin Pathol, 13(2), 156-159. doi:10.1136/jcp.13.2.156
Feidi, I. (2018). Will the new large-scale aquaculture projects make Egypt self-sufficient in fish supplies? Mediterranean Fisheries and Aquaculture Research, 1(1), 31-41.
Finnegan, M. C., Baxter, L. R., Maul, J. D., Hanson, M. L., & Hoekstra, P. F. (2017). Comprehensive characterization of the acute and chronic toxicity of the neonicotinoid insecticide thiamethoxam to a suite of aquatic primary producers, invertebrates, and fish. Environmental Toxicology and Chemistry, 36(10), 28382848.
Fırat, Ö., & Tutus, R. (2020). Comparative Acute Toxicity Assessment of Organophosphate and Avermectin Insecticides on a Freshwater Fish Oreochromis niloticus. Bulletin of Environmental Contamination and Toxicology, 105(4), 582587.
Fırat, Ö., Cogun, H. Y., Yüzereroğlu, T. A., Gök, G., Fırat, Ö., Kargin, F., & Kötemen, Y. (2011). A comparative study on the effects of a pesticide (cypermethrin) and two metals (copper, lead) to serum biochemistry of Nile tilapia, Oreochromis niloticus. Fish Physiology and Biochemistry, 37(3), 657-666.
Fossati, P., & Prencipe, L. (1982). Serum triglycerides determined colorimetrically with an enzyme that produces hydrogen peroxide. Clinical Chemistry, 28(10), 20772080.
Fox, B. K., Breves, J. P., Hirano, T., & Grau, E. G. (2009). Effects of short- and longterm fasting on plasma and stomach ghrelin, and the growth hormone/insulin-like growth factor I axis in the tilapia, Oreochromis mossambicus. Domestic Animal Endocrinology, 37(1), 1-11.
Galappaththi, I. D. L., Dissanayake, R., Welgama, T. W., Somachandara, U. A., Weerarathna, R. S., & Pathirana, G. Y. (2020). Identifying the Empirical Gaps in the Relationships between Student Engagement and Their Academic Achievement: Future Research Perspectives. . South Asian Journal of Social Studies and Economics, 5( 4), 1-8.
Ganeshwade, R. (2012). Effect of dimethoate on the level of cholesterol in freshwater Puntius ticto (Ham). Science Research Reporter, 11(1.0474), 16.1333.
Gardner, D. E., Hayes, A. W., & Thomas, J. A. (2001). New Perspectives: Toxicology and the Environment: Taylor & Francis Group.
Gayashani Sandamalika, W. M., Kwon, H., Lim, C., Yang, H., & Lee, J. (2021). The possible role of catalase in innate immunity and diminution of cellular oxidative stress: Insights into its molecular characteristics, antioxidant activity, DNA protection, and transcriptional regulation in response to immune stimuli in yellowtail clownfish (Amphiprion clarkii). Fish & Shellfish Immunology, 113, 106-117.
Georgieva, E., Stoyanova, S., Velcheva, I., & Yancheva, V. (2014). Histopathological
Alterations in Common Carp (Cyprinus carpio L.) Gills Caused by Thiamethoxam. Brazilian Archives of Biology and Technology, 57.
Ghaffar, A., Hussain, R., Abbas, G., Ali, M. H., Saleem, M., Khan, T., . . . Ahmad, H. (2017). Cumulative Effects of Sodium Arsenate and Diammonium Phosphate on Growth Performance, Hemato-Biochemistry and Protoplasm in Commercial Layer. Pakistan veterinary journal, 37(3).
Ghaffar, A., Hussain, R., Abbas, G., Khan, R., Akram, K., Latif, H., . . . Khan, A. (2021). Assessment of genotoxic and pathologic potentials of fipronil insecticide in Labeo rohita (Hamilton, 1822). Toxin Reviews, 40(4), 1289-1300.
Ghaffar, A., Hussain, R., Noreen, S., Abbas, G., Chodhary, I. R., Khan, A., . . . Niaz, M. (2020). Dose and time-related pathological and genotoxic studies on thiamethoxam in fresh water fish (Labeo rohita) in Pakistan. Pakistan veterinary journal, 40(2), 151-156.
Gibbons, D., Morrissey, C., & Mineau, P. (2015). A review of the direct and indirect effects of neonicotinoids and fipronil on vertebrate wildlife. Environmental Science and Pollution Research, 22(1), 103-118.
Gopal, V., Parvathy, S., & Balasubramanian, P. R. (1997). Effect of Heavy Metals on the Blood Protein Biochemistry of the Fish CYPRINUS CARPIO AND ITS USE AS A BIO-INDICATOR OF POLLUTION STRESS. Environmental Monitoring and Assessment, 48(2), 117-124.
Gornal A.C., Bardawill C.J., David M. M. (1949). Determination of Serum Protein by Means of Biuret Reaction. J. Biol. Chem., 177:751.
Grammer, G. L., Slack, W. T., Peterson, M. S., & Dugo, M. A. (2012). Nile tilapia Oreochromis niloticus (Linnaeus, 1758) establishment in temperate Mississippi, USA: multi-year survival confirmed by otolith ages. Aquatic Invasions, 7(3), 367376.
Green, T., Toghill, A., Lee, R., Waechter, F., Weber, E., Peffer, R., . . . Robinson, M.
(2005). Thiamethoxam Induced Mouse Liver Tumors and Their Relevance to Humans: Part 2: Species Differences in Response. Toxicological Sciences, 86(1), 48-55.
Gröner, F., Ziková, A., & Kloas, W. (2015). Effects of the pharmaceuticals diclofenac and metoprolol on gene expression levels of enzymes of biotransformation, excretion pathways and estrogenicity in primary hepatocytes of Nile tilapia (Oreochromis niloticus). Comparative Biochemistry and Physiology Part C: Toxicology & Pharmacology, 167, 51-57.
Gu, D. E., Luo, D., Xu, M., Ma, G. M., Mu, X. D., Luo, J. R., & Hu, Y. C. (2014). Species diversity defends against the invasion of Nile tilapia (Oreochromis niloticus). Knowl. Managt. Aquatic Ecosyst.(414), 07.
Gu, D., Hu, Y., Wei, H., Zhu, Y., Mu, X., Luo, D., . . . Yang, Y. (2017). Nile Tilapia Oreochromis niloticus (L.). In F. Wan, M. Jiang, & A. Zhan (Eds.), Biological Invasions and Its Management in China: Volume 2 (pp. 77-89). Singapore: Springer Singapore.
Guedegba, N. L., Imorou Toko, I., Ben Ammar, I., François, L., Oreins, N., Palluel, O., . . . Kestemont, P. (2021). chronic effects of a binary insecticide Acer 35 EC on Nile tilapia Oreochromis niloticus through a multi-biomarker approach. Chemosphere, 273, 128530.
Gul, S. T., Khan, A., Farooq, M., Niaz, S., Ahmad, M., Khatoon, A., . . . Hassan, M. F. (2017). Effect of sub lethal doses of thiamethoxam (a pesticide) on hematobiochemical values in cockerels. Pakistan veterinary journal, 37(2), 135-138.
Günal, A. Ç., Erkmen, B., Paçal, E., Arslan, P., Yildirim, Z., & Erkoç, F. (2019). Sublethal Effects of Imidacloprid on Nile Tilapia (Oreochromis niloticus). Water, Air, & Soil Pollution, 231(1), 4.
Hamed, H. S., & Osman, A. G. M. (2017). Modulatory effect of lycopene against carbofuran toxicity in African catfish, Clarias gariepinus. Fish Physiology and Biochemistry, 43(6), 1721-1731.
HASAN, M. M., HASAN, M. M., UDDIN, M. H., SUMON, K. A., AL-AMIN, &
RASHID, H. (2021). Histopathological alterations in the gills of banded gourami (Trichogaster fasciata) exposed to thiamethoxam. Bangladesh Journal of Fisheries, 33(1), 49-56.
Hasan, M. M., Uddin, M. H., Islam, M. J., Biswas, S., Sumon, K. A., Prodhan, M. D. H., & Rashid, H. (2023). Histopathological Alterations in Liver and Kidney Tissues of Banded Gourami (Trichogaster fasciata) Exposed to Thiamethoxam.
Aquaculture Studies, 23(1).
Hassan, H. B., Mohamed, E. A., Abdel Fatah, H., & Mohamed, K. A. (2019). An analytical economic study of fish production in Egypt. Middle East J. Agric. Res, 8(1), 139-152.
Hathout, H. M. R., Sobhy, H. M., Abou-Ghanima, S., & El-Garawani, I. M. (2021). Ameliorative role of ascorbic acid on the oxidative stress and genotoxicity induced by acetamiprid in Nile tilapia (Oreochromis niloticus). Environmental Science and Pollution Research, 28(39), 55089-55101.
Hladik, M. L., Main, A. R., & Goulson, D. (2018). Environmental Risks and Challenges Associated with Neonicotinoid Insecticides. Environmental Science & Technology, 52(6), 3329-3335.
Hoffmann, G. E., Schleicher, E., Weiss, L., & Hoffmann, S. (1982). Comparison of
Two Methods for Very Low Density and Low Density Lipoprotein Cholesterol Determination. 20(6), 457-460. doi:doi:10.1515/cclm.1982.20.6.457
Hossain, M. A., Sutradhar, L., Sarker, T. R., Saha, S., & Iqbal, M. M. (2022). Toxic effects of chlorpyrifos on the growth, hematology, and different organs histopathology of Nile tilapia, Oreochromis niloticus. Saudi Journal of Biological Sciences, 29(7), 103316.
Huang, C., Feng, L., Liu, X.-A., Jiang, W.-D., Wu, P., Liu, Y., . . . Zhou, X.-Q. (2020). The toxic effects and potential mechanisms of deoxynivalenol on the structural integrity of fish gill: Oxidative damage, apoptosis and tight junctions disruption. Toxicon, 174, 32-42.
Huang, D., Li, S., Lu, Y., Sha, M., & Li, J. (2023). Effects of diflubenzuron on shrimp (Neocaridina palmata) in freshwater systems dominated by submerged plant (Ceratophyllum demersum). Chemosphere, 313, 137567.
Hussain, R., Ghaffar, A., Abbas, G., Jabeen, G., Khan, I., Abbas, R. Z., . . . Khan, A. (2022). Thiamethoxam at sublethal concentrations induces histopathological, serum biochemical alterations and DNA damage in fish (Labeo rohita). Toxin Reviews, 41(1), 154-164.
Ihara, M., & Matsuda, K. (2018). Neonicotinoids: molecular mechanisms of action, insights into resistance and impact on pollinators. Current Opinion in Insect Science, 30, 86-92.
Ilahi, I., Waqas, Ullah, S., Ali, H., Begum, R., Nawaz, H., . . . Bibi, S. (2018). Effect of long term exposure to sublethal concentration of imidacloprid on some biochemical and haematological parameters of Grass carp and Goldfish. PAKISTAN JOURNAL OF PHARMACEUTICAL SCIENCES, 31(6), 2655-
2660.
Ismail, H. T., & Mahboub, H. H. (2016). Effect of acute exposure to nonylphenol on biochemical, hormonal, and hematological parameters and muscle tissues residues of Nile tilapia; Oreochromis niloticus. Vet World, 9(6), 616-625.
Jenkins, F., Smith, J., Rajanna, B., Shameem, U., Umadevi, K., Sandhya, V., & Madhavi, R. (2003). Effect of Sub-Lethal Concentrations of Endosulfan on Hematological and Serum Biochemical Parameters in the Carp Cyprinus carpio. Bulletin of Environmental Contamination and Toxicology, 70(5), 0993-0997.
Jeschke, P., Nauen, R., Schindler, M., & Elbert, A. (2011). Overview of the Status and Global Strategy for Neonicotinoids. Journal of Agricultural and Food Chemistry, 59(7), 2897-2908.
Jin, Y., Zhang, X., Shu, L., Chen, L., Sun, L., Qian, H., . . . Fu, Z. (2010). Oxidative stress response and gene expression with atrazine exposure in adult female zebrafish (Danio rerio). Chemosphere, 78(7), 846-852.
Jönsson, E. (2013). The role of ghrelin in energy balance regulation in fish. General and Comparative Endocrinology, 187, 79-85.
Karabay, N. U., & Oguz, M. G. (2005). Cytogenetic and genotoxic effects of the insecticides, imidacloprid and methamidophos. Genetics and Molecular Research, 4(4), 653-662.
Kaya, H., Çelik, E. Ş., Yılmaz, S., Tulgar, A., Akbulut, M., & Demir, N. (2015). Hematological, serum biochemical, and immunological responses in common carp (Cyprinus carpio) exposed to phosalone. Comparative Clinical Pathology, 24(3), 497-507.
Khalil, S. R., Awad, A., & Mohammed, H. H. (2017). Behavioral response and gene expression changes in fipronil-administered male Japanese quail (Coturnix japonica). Environmental Pollution, 223, 51-61.
Khalil, S. R., Elhakim, Y. A., Abd El-fattah, A. H., Ragab Farag, M., Abd ElHameed, N. E., & El-Murr, A. E. (2020). Dual immunological and oxidative responses in Oreochromis niloticus fish exposed to lambda cyhalothrin and concurrently fed with Thyme powder (Thymus vulgaris L.): Stress and immune encoding gene expression. Fish & Shellfish Immunology, 100, 208-218.
Khan, H. A. A., Akram, W., Iqbal, J., & Naeem-Ullah, U. (2015). Thiamethoxam Resistance in the House Fly, Musca domestica L.: Current Status, Resistance selection, Cross-Resistance Potential and Possible Biochemical Mechanisms. PLOS ONE, 10(5), e0125850.
Khan, M. F., Tabassum, S., Sadique, H., Sajid, M., Ghayyur, S., Dil, K., . . . Ullah, I. (2019). Hematological, biochemical and histopathological alterations in common carp during acute toxicity of endosulfan. Int J Agric Biol, 22(4), 703-709.
Kocamaz, D., & Oruc, E. (2018). Assessment of synergistic toxicity two commercial pesticides, thiamethoxam and lambda-cyhalothrin, on total antioxidant/oxidant status, oxidative stress index and somatic indices in different tissues of tilapia. Fresenius Environmental Bulletin, 27(4), 2312-2319.
Kojima, M., Masui, T., Nemoto, K., & Degawa, M. (2004). Lead nitrate-induced development of hypercholesterolemia in rats: sterol-independent gene regulation of hepatic enzymes responsible for cholesterol homeostasis. Toxicology Letters, 154(1), 35-44.
Koracevic, D., Koracevic, G., Djordjevic, V., Andrejevic, S., & Cosic, V. (2001). Method for the measurement of antioxidant activity in human fluids. Journal of clinical pathology, 54(5), 356-361.
Kumar, G., & Engle, C. R. (2016). Technological Advances that Led to Growth of Shrimp, Salmon, and Tilapia Farming. Reviews in Fisheries Science & Aquaculture, 24(2), 136-152.
Kumar, V., Janaiah, C., & Venkateshwarlu, P. (2010). Effect of thiamethoxam alters serum biochemical parameters in Channa punctatus (Bloch). Asian Journal of Bio Science, 5(1), 106-110.
Lal, B., Sarang, M. K., & Kumar, P. (2013). Malathion exposure induces the endocrine disruption and growth retardation in the catfish, Clarias batrachus (Linn.). General and Comparative Endocrinology, 181, 139-145.
Lobson, C., Luong, K., Seburn, D., White, M., Hann, B., Prosser, R. S., . . . Hanson, M. L. (2018). Fate of thiamethoxam in mesocosms and response of the zooplankton community. Science of The Total Environment, 637-638, 1150-1157.
Logaswamy, S., & Remia, K. (2009). Impact of cypermethrin and ekalux on respiratory and some biochemical activities of a freshwater fish, Tilapia mossambica. Current Biotica, 3(1), 65-73.
Mahmoud, H. K., Farag, M. R., Reda, F. M., Alagawany, M., & Abdel-Latif, H. M. R. (2022). Dietary supplementation with Moringa oleifera leaves extract reduces the impacts of sub-lethal fipronil in Nile tilapia, Oreochromis niloticus. Scientific Reports, 12(1), 21748.
Mahmoud, H. K., Reda, F. M., Alagawany, M., & Farag, M. R. (2021). The stress of abamectin toxicity reduced water quality, growth performance, immunity and antioxidant capacity of Oreochromis niloticus fish: Modulatory role of Simmondsia chinensis extract as a dietary supplement. Aquaculture, 534, 736247.
Maienfisch, P., Angst, M., Brandl, F., Fischer, W., Hofer, D., Kayser, H., . . . Widmer, H. (2001). Chemistry and biology of thiamethoxam: a second generation neonicotinoid. Pest Management Science, 57(10), 906-913.
Marlatt, V. L., Leung, T. Y. G., Calbick, S., Metcalfe, C., & Kennedy, C. (2019). Sublethal effects of a neonicotinoid, clothianidin, on wild early life stage sockeye salmon (Oncorhynchus nerka). Aquatic Toxicology, 217, 105335.
Mesnage, R., Biserni, M., Genkova, D., Wesolowski, L., & Antoniou, M. N. (2018). Evaluation of neonicotinoid insecticides for oestrogenic, thyroidogenic and adipogenic activity reveals imidacloprid causes lipid accumulation. Journal of Applied Toxicology, 38(12), 1483-1491.
Midhun, S. J., Neethu, S., Arun, D., Vysakh, A., Divya, L., Radhakrishnan, E. K., & Jyothis, M. (2019). Dietary supplementation of Bacillus licheniformis HGA8B improves growth parameters, enzymatic profile and gene expression of Oreochromis niloticus. Aquaculture, 505, 289-296.
Modesto, K. A., & Martinez, C. B. R. (2010). Roundup® causes oxidative stress in liver and inhibits acetylcholinesterase in muscle and brain of the fish Prochilodus lineatus. Chemosphere, 78(3), 294-299.
Mohamed, I. A., Hamed, M., Abdel-Tawab, H. S., Mansour, S., Soliman, H. A. M., Lee, J.-S., & El-Din H. Sayed, A. (2022). Multi-biomarkers approach to assess the toxicity of novel insecticide (Voliam flexi®) on Clarias gariepinus: from behavior to immunotoxicity. Fish & Shellfish Immunology, 125, 54-64.
Mokhbatly, A.-A. A., Assar, D. H., Ghazy, E. W., Elbialy, Z., Rizk, S. A., Omar, A.
A., . . . Dawood, M. A. O. (2020). The protective role of spirulina and β-glucan in
African catfish (Clarias gariepinus) against chronic toxicity of chlorpyrifos: hemato-biochemistry, histopathology, and oxidative stress traits. Environmental Science and Pollution Research, 27(25), 31636-31651.
Mukherjee, D., Saha, S., Chukwuka, A. V., Ghosh, B., Dhara, K., Saha, N. C., . . . Faggio, C. (2022). Antioxidant enzyme activity and pathophysiological responses in the freshwater walking catfish, Clarias batrachus Linn under sub-chronic and chronic exposures to the neonicotinoid, Thiamethoxam®. Science of The Total Environment, 836, 155716.
Mutlu, E., Aydın, S., & Kutlu, B. (2015). Alterations of growth performance and blood chemistry in nile tilapia (Oreochromis nuoticus) affected by copper sulfate in long-term exposure. Turkish Journal of Fisheries and Aquatic Sciences, 15(3), 481-488.
Mwegoha, W., Kaseva, M., & Sabai, S. (2010). Mathematical modeling of dissolved oxygen in fish ponds. African Journal of Environmental Science and Technology, 4(9), 625-638.
Narra, M. R., Rajender, K., Reddy, R. R., Murty, U. S., & Begum, G. (2017). Insecticides induced stress response and recuperation in fish: Biomarkers in blood and tissues related to oxidative damage. Chemosphere, 168, 350-357.
Nath, S., Bose, S., & Kundu, I. (2012). Effects of Thiamethoxam on Liver Protein of Oreochromis niloticus (Trewavas). Proceedings of the Zoological Society, 65(2), 118-120.
Nishikimi M, Appaji N, Yagi K. (1972). The occurrence of superoxide anion in the reaction of reduced phenazine methosulfate and molecular oxygen. Biochem Biophys Res Commun. 31;46(2):849-54.
Nithyananthan, S., & Thirunavukkarasu, C. (2019). Chemotherapeutic doses of arsenic trioxide delays hepatic regeneration by oxidative stress and hepatocyte apoptosis in partial hepatectomy rat. Toxicology and Applied Pharmacology, 382, 114760.
Nordborg, M., Davis, J., Cederberg, C., & Woodhouse, A. (2017). Freshwater ecotoxicity impacts from pesticide use in animal and vegetable foods produced in Sweden. Science of The Total Environment, 581-582, 448-459.
Oghale, O., Okoboshi, A., Chinedu-Ndukwe, A., Kanu, K., Beka, M., & Avoaja, D. (2021). Effects of Dimethoate Insecticide on Serum Biochemistry of African Catfish (Clarias gariepinus) Juveniles. Journal of Applied Sciences and Environmental Management, 25(6), 977-985.
Ohkawa H., Ohishi W. & Yagi K. (1979): Assay for lipid peroxides in animal tissues by thiobarbituric acid reaction. Anal. Biochem., 95:351-358.
Onada, O., & Ogunola, O. (2017). Effects of catfish brood-stocks Egg combination on hatchability and survival of fish larvae. Journal of Aquaculture Research and Development S, 2, 1-5.
Öner, M., Atli, G., & Canli, M. (2008). Changes in serum biochemical parameters of freshwater fish Oreochromis niloticus following prolonged metal (Ag, Cd, Cr, Cu, Zn) exposures. Environmental Toxicology and Chemistry, 27(2), 360-366.
Osuna-Flores, I., Pérez-Morales, A., Olivos-Ortiz, A., & Álvarez-González, C. A. (2019). Effect of organophosphorus pesticides in juveniles of Litopenaeus vannamei: alteration of glycogen, triglycerides, and proteins. Ecotoxicology, 28(6), 698-706.
PĂUNESCU, A., PONEPAL, C. M., DRĂGHICI, O., & MARINESCU, A. G. (2010). THE ACTION OF SOME INSECTICIDES UPON PHYSIOLOGICAL INDICES
IN RANA (PELOPHYLAX) RIDIBUNDA. Ovidius University Annals of Natural
Sciences, 14(1), 79-82.
Perschbacher, P. W., & Ludwig, G. M. (2004). Effects of diuron and other aerially applied cotton herbicides and defoliants on the plankton communities of aquaculture ponds. Aquaculture, 233(1), 197-203.
Phillips, B. M., Voorhees, J. P., Siegler, K., McCalla, L., Meertens, P., Bower, J., & Tjeerdema, R. S. (2022). Acute and chronic Effects of Clothianidin, Thiamethoxam and Methomyl on Chironomus dilutus. Bulletin of Environmental Contamination and Toxicology, 108(5), 884-889.
Qi, S., Wang, D., Zhu, L., Teng, M., Wang, C., Xue, X., & Wu, L. (2018). Neonicotinoid insecticides imidacloprid, guadipyr, and cycloxaprid induce acute oxidative stress in Daphnia magna. Ecotoxicology and Environmental Safety, 148, 352-358.
Raibeemol, K. P., & Chitra, K. C. (2018). Hematological and biochemical changes in the freshwater fish, Pseudetroplus maculatus exposed to sublethal concentrations of chlorpyrifos. Research & Reviews: A Journal of Life Sciences, 8(3), 108-116.
RANIA, A., & NEDJOUA, E. Z. (2023). GROWTH AND NUTRIENT LEVELS OF A FRESHWATER FISH TREATED WITH NEONICOTINOID PESTICIDE
ADDED TO THE REARING WATER. Water and Environment, 171.
Reitman A. and Frankel S. (1957): A colourimetric method for the determination of serum glutamic oxaloacetate and glutamic pyruvic transaminases. Am. J. Clin. Pathol., 28:56-63.
Remia, K., Logaswamy, S., Logankumar, K., & Rajmohan, D. (2008). Effect of an insecticide (Monocrotophos) on some biochemical constituents of the fish Tilapia mossambica. Poll. Res, 27(3), 523-526.
Rocha, C. P., Cabral, H. N., Marques, J. C., & Gonçalves, A. M. (2022). A global overview of aquaculture food production with a focus on the activity’s development in transitional systems—The case study of a South European Country (Portugal). Journal of Marine Science and Engineering, 10(3), 417.
Sabra, F. S., & Mehana, E.-S. E.-D. (2015). Pesticides toxicity in fish with particular reference to insecticides. Asian Journal of Agriculture and Food Sciences, 3(1).
Salbego, J., Seben, D., Sippert, L. R., Gressler, L. T., Arruda da Cunha, J., Zanella, R., . . . Golombieski, J. I. (2020). Toxicological response of silver catfish (Rhamdia quelen) after acute exposure to a commercial insecticide containing thiamethoxam. Journal of Environmental Science and Health, Part B, 55(8), 749755.
Samanta, M., Swain, B., Basu, M., Panda, P., Mohapatra, G. B., Sahoo, B. R., & Maiti, N. K. (2012). Molecular characterization of toll-like receptor 2 (TLR2), analysis of its inductive expression and associated down-stream signaling molecules following ligands exposure and bacterial infection in the Indian major carp, rohu (Labeo rohita). Fish & Shellfish Immunology, 32(3), 411-425.
Sánchez-Bayo, F., & Goka, K. (2005). Unexpected effects of zinc pyrithione and imidacloprid on Japanese medaka fish (Oryzias latipes). Aquatic Toxicology, 74(4), 285-293.
Sapana Devi, M., & Gupta, A. (2014). Sublethal toxicity of commercial formulations of deltamethrin and permethrin on selected biochemical constituents and enzyme activities in liver and muscle tissues of Anabas testudineus. Pesticide Biochemistry and Physiology, 115, 48-52.
Saqer, B. T., Al-aubadi, I. M., & Ali, A. J. (2019). Study on the effect of imidacloprid in blood, liver and kidney on adult male albino mice. Biochemical & Cellular Archives, 19(2).
Seltenrich, N. (2017). Catching Up with Popular Pesticides: More Human Health Studies
Are Needed on Neonicotinoids. Environmental Health Perspectives, 125(2), A41A42. doi:doi:10.1289/ehp.125-A41
Shaalan, M., El-Mahdy, M., Saleh, M., & El-Matbouli, M. (2018). Aquaculture in Egypt: Insights on the Current Trends and Future Perspectives for Sustainable Development. Reviews in Fisheries Science & Aquaculture, 26(1), 99-110.
Shahjahan, M., Islam, M. J., Hossain, M. T., Mishu, M. A., Hasan, J., & Brown, C. (2022). Blood biomarkers as diagnostic tools: An overview of climate-driven stress responses in fish. Science of The Total Environment, 843, 156910.
Shahjahan, M., Kabir, M. F., Sumon, K. A., Bhowmik, L. R., & Rashid, H. (2017). Toxicity of organophosphorus pesticide sumithion on larval stages of stinging catfish Heteropneustes fossilis. Chinese Journal of Oceanology and Limnology, 35(1), 109-114.
Sharafeldin, K., Abdel-Gawad, H., Ramzy, E., Sweilum, M., & Nagy, M. (2015). Harmful impact of profenofos on the physiological parameters in Nile tilapia, Oreochromis niloticus. International Journal of Basic and Applied Sciences, 4(1), 19-26.
Shehata, G. A. B., & Eldal, N. M. A. (2022). Some Economic Aspects of Fish Food Security in Egypt. Open Journal of Social Sciences, 10(5), 351-366.
Shi, X., Dick, R. A., Ford, K. A., & Casida, J. E. (2009). Enzymes and Inhibitors in Neonicotinoid Insecticide Metabolism. Journal of Agricultural and Food Chemistry, 57(11), 4861-4866.
Soliman, N. F. (2017). Aquaculture in Egypt under changing climate. Alexandria Research Center for Adaptation to Climate Change (ARCA): Alexandria, Egypt.
Stoskopf, M. K. (1993). Fish medicine: W.B. Saunders Co.
Stoyanova, S., Yancheva, V., Iliev, I., Vasileva, T., Bivolarski, V., Velcheva, I., & Georgieva, E. (2016). Biochemical, histological and histochemical changes in Aristichthys nobilis Rich. liver exposed to thiamethoxam. PERIODICUM BIOLOGORUM, 118(1), 29-36.
Sweilum, M. A. (2006). Effect of sublethal toxicity of some pesticides on growth parameters, haematological properties and total production of Nile tilapia (Oreochromis niloticus L.) and water quality of ponds. Aquaculture Research, 37(11), 1079-1089.
Tacon, A. G. J. (2020). Trends in Global Aquaculture and Aquafeed Production: 2000– 2017. Reviews in Fisheries Science & Aquaculture, 28(1), 43-56.
Tacon, A. G. J., & Metian, M. (2013). Fish Matters: Importance of Aquatic Foods in
Human Nutrition and Global Food Supply. Reviews in Fisheries Science, 21(1), 22-38.
Taheri Mirghaed, A., Ghelichpour, M., Mirzargar, S. S., Joshaghani, H., & Ebrahimzadeh Mousavi, H. (2018). Toxic effects of indoxacarb on gill and kidney histopathology and biochemical indicators in common carp (Cyprinus carpio). Aquaculture Research, 49(4), 1616-1627.
Tang, J., Wang, W., Jiang, Y., & Chu, W. (2021). Diazinon exposure produces histological damage, oxidative stress, immune disorders and gut microbiota dysbiosis in crucian carp (Carassius auratus gibelio). Environmental Pollution, 269, 116129.
Temiz, Ö., & Kargın, F. (2023). Responses to the Toxic Effects of the Neonicotinoid Thiamethoxam in Oreochromis niloticus Tissues Using Multiple Biomarkers. Research square.
Temiz, Ö., Kargın, D., & Çoğun, H. Y. (2021). In Vivo Effects on Stress Protein, Genotoxicity, and Oxidative Toxicity Parameters in Oreochromis niloticus Tissues Exposed to Thiamethoxam. Water, Air, & Soil Pollution, 232(6), 221.
Thany, S. H. (2010). Neonicotinoid Insecticides. In S. H. Thany (Ed.), Insect Nicotinic Acetylcholine Receptors (pp. 75-83). New York, NY: Springer New York.
Thompson, D. A., Lehmler, H.-J., Kolpin, D. W., Hladik, M. L., Vargo, J. D., Schilling, K. E., . . . Field, R. W. (2020). A critical review on the potential impacts of neonicotinoid insecticide use: current knowledge of environmental fate, toxicity, and implications for human health. Environmental Science: Processes & Impacts, 22(6), 1315-1346.
Tian, X., Hong, X., Yan, S., Li, X., Wu, H., Lin, A., & Yang, W. (2020). Neonicotinoids caused oxidative stress and DNA damage in juvenile Chinese rare minnows (Gobiocypris rarus). Ecotoxicology and Environmental Safety, 197, 110566.
Tian, X., Yang, W., Wang, D., Zhao, Y., Yao, R., Ma, L., . . . Lin, A. (2018). chronic brain toxicity response of juvenile Chinese rare minnows (Gobiocypris rarus) to the neonicotinoid insecticides imidacloprid and nitenpyram. Chemosphere, 210, 1006-1012.
Tišler, T., Jemec, A., Mozetič, B., & Trebše, P. (2009). Hazard identification of imidacloprid to aquatic environment. Chemosphere, 76(7), 907-914.
Ullah, S., & Zorriehzahra, M. J. (2014). Ecotoxicology: a review of pesticides induced toxicity in fish. Advances in Animal and Veterinary Sciences, 3(1), 40-57.
Ullah, S., & Zorriehzahra, M. J. (2015). Ecotoxicology: a review of pesticides induced toxicity in fish. Advances in Animal and Veterinary Sciences, 3(1), 40-57.
Unniappan, S., & Peter, R. E. (2005). Structure, distribution and physiological functions of ghrelin in fish. Comparative Biochemistry and Physiology Part A: Molecular & Integrative Physiology, 140(4), 396-408.
Valavanidis, A. (2018). Neonicotinoid insecticides. Banned by the European Union in 2018 after scientific studies concluded that harm honey bees. Sci. Rev, 37, 1-20.
Vali, S., Majidiyan, N., Azadikhah, D., Varcheh, M., Tresnakova, N., & Faggio, C. (2022). Effects of Diazinon on the Survival, Blood Parameters, Gills, and Liver of Grass Carp (Ctenopharyngodon idella Valenciennes, 1844; Teleostei: Cyprinidae). Water, 14(9), 1357.
Van den Brink, P. J. (2013). ASSESSING AQUATIC POPULATION AND COMMUNITY-LEVEL RISKS OF PESTICIDES. Environmental Toxicology and
Chemistry, 32(5), 972-973.
Veedu, S. K., Ayyasamy, G., Tamilselvan, H., & Ramesh, M. (2022). Single and joint toxicity assessment of acetamiprid and thiamethoxam neonicotinoids pesticides on biochemical indices and antioxidant enzyme activities of a freshwater fish Catla catla. Comparative Biochemistry and Physiology Part C: Toxicology & Pharmacology, 257, 109336.
Velisek, J., & Stara, A. (2018). Effect of thiacloprid on early life stages of common carp (Cyprinus carpio). Chemosphere, 194, 481-487.
Victoria, S., Hein, M., Harrahy, E., & King-Heiden, T. C. (2022). Potency matters: Impacts of embryonic exposure to nAChR agonists thiamethoxam and nicotine on hatching success, growth, and neurobehavior in larval zebrafish. Journal of Toxicology and Environmental Health, Part A, 85(18), 767-782.
Vieira, C. E. D., Pérez, M. R., Acayaba, R. D. A., Raimundo, C. C. M., & dos Reis Martinez, C. B. (2018). DNA damage and oxidative stress induced by imidacloprid exposure in different tissues of the Neotropical fish Prochilodus lineatus. Chemosphere, 195, 125-134.
Vignet, C., Cappello, T., Fu, Q., Lajoie, K., De Marco, G., Clérandeau, C., . . . Cachot, J. (2019). Imidacloprid induces adverse effects on fish early life stages that are more severe in Japanese medaka (Oryzias latipes) than in zebrafish (Danio rerio). Chemosphere, 225, 470-478.
Walker, H. K., Hall, W. D., & Hurst, J. W. (1990). Clinical methods: the history, physical, and laboratory examinations.
Wang, J., Yin, R., Liu, Y., Wang, B., Wang, N., Xiao, P., . . . Hirai, H. (2023). Metaanalysis of neonicotinoid insecticides in global surface waters. Environmental Science and Pollution Research, 30(1), 1039-1047.
Wang, Y. Y. L., Xiong, J., Ohore, O. E., Cai, Y.-E., Fan, H., Sanganyado, E., . . . Wang, Z. (2022). Deriving freshwater guideline values for neonicotinoid insecticides: Implications for water quality guidelines and ecological risk assessment. Science of The Total Environment, 828, 154569.
Wang, Y., Zhang, Y., Zeng, T., Li, W., Yang, L., & Guo, B. (2019). Accumulation and toxicity of thiamethoxam and its metabolite clothianidin to the gonads of Eremias argus. Science of The Total Environment, 667, 586-593.
Yan, S. H., Wang, J. H., Zhu, L. S., Chen, A. M., & Wang, J. (2016). Thiamethoxam induces oxidative stress and antioxidant response in zebrafish (Danio Rerio) livers. Environmental Toxicology, 31(12), 2006-2015.
Yang, J., Guo, C., Luo, Y., Fan, J., Wang, W., Yin, X., & Xu, J. (2023). Effect of thiamethoxam on the behavioral profile alteration and toxicity of adult zebrafish at environmentally relevant concentrations. Science of The Total Environment, 858, 159883.
Yang, Y., Su, L., Huang, Y., Zhang, X., Li, C., Wang, J., . . . Zhao, Y. H. (2022). Biouptake, tissue distribution and metabolism of a neonicotinoid insecticide clothianidin in zebrafish. Environmental Pollution, 292, 118317.
Yang, Y., Yu, Q., Zhang, C., Wang, X., He, L., Huang, Y., . . . Chen, L. (2023). Acute thiamethoxam exposure induces hepatotoxicity and neurotoxicity in juvenile Chinese mitten crab (Eriocheir sinensis). Ecotoxicology and Environmental Safety, 249, 114399.
Yeates, R. A., Mannik, T., & Calvert, G. D. (1979). The measurement of plasma-HDLcholesterol by precipitation techniques. Pathology, 11(2), 324.
Yousef, M. I., El-Demerdash, F. M., Kamel, K. I., & Al-Salhen, K. S. (2003). Changes in some hematological and biochemical indices of rabbits induced by isoflavones and cypermethrin. Toxicology, 189(3), 223-234.
Yousefi, M., Paktinat, M., Mahmoudi, N., Pérez-Jiménez, A., & Hoseini, S. M. (2016). Serum biochemical and non-specific immune responses of rainbow trout (Oncorhynchus mykiss) to dietary nucleotide and chronic stress. Fish Physiology and Biochemistry, 42(5), 1417-1425.
Yuan, J. S., Reed, A., Chen, F., & Stewart, C. N. (2006). Statistical analysis of real-time PCR data. BMC Bioinformatics, 7(1), 85. doi:10.1186/1471-2105-7-85
Zhang, J., Zhu, M., Wang, Q., & Yang, H. (2023). The Combined Use of Copper Sulfate and Trichlorfon Exerts Stronger Toxicity on the Liver of Zebrafish. International Journal of Molecular Sciences, 24(13), 11203.
Zhang, J.-G., Ma, D.-D., Xiong, Q., Qiu, S.-Q., Huang, G.-Y., Shi, W.-J., & Ying, G.G. (2021). Imidacloprid and thiamethoxam affect synaptic transmission in zebrafish. Ecotoxicology and Environmental Safety, 227, 112917.
Zhang, Y.-M., Xu, W.-B., Lin, C.-Y., Li, B.-Z., & Shu, M.-A. (2023). Selenium alleviates biological toxicity of thiamethoxam (TMX): Bioaccumulation of TMX, organ damage, and antioxidant response of red swamp crayfish (Procambarus clarkii). Journal of Hazardous Materials, 458, 131896.
Zhao, H., Wang, Y., Guo, M., Mu, M., Yu, H., & Xing, M. (2020). Grass carps coexposed to environmentally relevant concentrations of cypermethrin and sulfamethoxazole bear immunodeficiency and are vulnerable to subsequent Aeromonas hydrophila infection. Environmental Pollution, 266, 115156.
Zhong, H., Hu, Y., & Yu, F. (2021). A review on ghrelin and fish reproduction.
Reproduction and Breeding, 1(2), 128-135.
Zhou, Y., Chen, X., Teng, M., Zhang, J., & Wang, C. (2019). Toxicity effects of captan on different life stages of zebrafish (Danio rerio). Environmental Toxicology and Pharmacology, 69, 80-85.
Zhu, L., Li, W., Zha, J., Li, N., & Wang, Z. (2019). chronic thiamethoxam exposure impairs the HPG and HPT axes in adult Chinese rare minnow (Gobiocypris rarus): Docking study, hormone levels, histology, and transcriptional responses. Ecotoxicology and Environmental Safety, 185, 109683.
Zou, Q., Huang, Y., Cao, J., Zhao, H., Wang, G., Li, Y., & Pan, Q. (2017). Effects of four feeding stimulants in high plant-based diets on feed intake, growth performance, serum biochemical parameters, digestive enzyme activities and appetite-related genes expression of juvenile GIFT tilapia (Oreochromis sp.).
Aquaculture Nutrition, 23(5), 1076-1085.
الولخص العربى
تأثير تلىث الوياه بوبيد الثياهيثىكسام على الحالة الصحية لأسواك البلطى النيلي
٠ؼرّّذ أوصش ِٓ ٔظف عىاعىاْ ا ؼاٌاٌؼاٌُ ػػٍٝ الأعّّان وّّظذس سئ١غٟ ثشٌٍٚثشٚذٚذ١ٓ اٌح١ أٛأٟ وّّا٠ ؼرثش الاعرضساع اٌ غّ ىاٌغّىٟ
ِظذس ُِٙ ِٓ ِظادس ذٛٛف١ش اٌ ثشٚٚذ١ٓ ِ١غٛٛس اٌ رىٍٍفح تالإػافح إإٌٝ رٌٌه٠ ٛفش فشص ػّػًّ ٍؼذ٠ذ ِٓ اٌ ٕاط فٟ ظّ ١غ أٔٔحاء اٌ ؼااٌؼاٌُ. ٠ؼرثش اٌ ثٍ طٟ ِٓ أٔ ٛاع الأعّّان اٌٌشائؼح ا رٟ٠ رُ اعرضساػٙٙا فٟ ظّ ١غ أٔٔحاء اٌ ؼااٌؼاٌُ. ففٟ ا ؼاَ 2112، اصد٘٘ش إٔراض ا ث طٟ فٟ ا ؼاٌاٌؼاٌُ ٌ١ظظً إإٌٝ 4.5 ٍِ١ْٛ ؽٓ ِٚٓ اٌ رٛٛلغ أأْ٠ ضداد تشىتشىً وث١ش خلاي ا غ ٛاخ ا مادِح.
أظش٠د زٖ اٌذساعح فٟ ؼِّؼًّ أِِشاع الأعّّان اٌٌراتغ ٌ ؼٙٙذ تحٛٛز ااٌظحح اٌح١ أ ١ح فشع الإعىٕٕذس٠ح -
ِظش خلاي اٌٌفرشج اٌ ّرذج ت١ٓ شٙ شٜ ٠ٌٛ١ٛ ٚأغغطظ ِٓ اٌ ؼاَ 2123 ٌرم١١ُ ذِٜذٜ ذأش١ش ذٍ ٛز اٌاٌّ١اٖ تّث١ذ ا ص١اِ ١ص وغاصٛوغاَ ػػٍٝ ا حاٌٌح اٌٌظح١ح الإٔراظ١ح لأعّّان ا ث طٝ اٌإٌ١ٍٝ ا ّغرضسػح. ػٍٚػٍ١ٗ فمذ ذُ اعرخذاَ ِغرحؼش اوراسا 25% ِٓ إٔٔراض ششوح ع١ عٕرا ِظشٚ اٌ زٜ ٠حرٛحرٜٛ ػػٍٝ 251 ظُ /وعُ ِٓ ا ص١ااِ١ص وغاَ. ٌذساعح ذأش١ش اٌ ّغرحؼش، ذُ ششاء ػذد 211 ِٓ اعّّان اٌ ثٍ طٝ اٌإٌ١ٍٝ تّ رٛٛعؾ ا صاٚصاْ 15 ± 5 ظُ ِٓ إحذٜ ِضاسع الأعّّان ِٓ ِحافظح وفشاٌٌش١خ – ِظش
ٚذُ إٔ ضاٌ ٙا فٟ أحٛٛاع صظاظ١ح عؼح 111 ٌرش تٙٙا ِ١اٖ خاٌ ١ح ِٓ اٌ ىٍ ٛس ٚ ضٚٚدج ترٙترٙٛ٠ح طٕٕاػ١ح .فٝ اٌٌثذا٠ح ذُ ذشت١ح الأعّّان ّذج عثؼح أ٠اَ لثً تذا٠ح اٌٌرعشتح فٝ ِ١اٖ خاٌ ١ح ِٓ اٌ ّغرحؼش ٌ١حذز اٌ رألٍاٌرألٍُ ذُ ذغز٠رٙٙا تأػلاف حث١ث١ح ِٓ إٔٔراض ششوح عى١رش٠ٕط ِظش ،31% تشٚٚذ١ٓ خاَ تّّؼذي 3% ِٓ صٚصْ اٌ غّّىح ِشذ١ٓ٠ ِٛ ً١ا ِغ ذغ١١ش اٌاٌّ١اٖ ظضئ١ا ِشذ١ٓ فٝ الأعثٛٛع تّّغاػذج أ ثٛٛب اٌٌشفؾ لاصاٌٌح اٌٌفؼلاخ ٚتما٠ا اٌ ؼٍف ّا٠ غاػذ ػٍػٍٝ إتماء الاحٛٛاع ٔظ١فح لذس الاِ ىاالاِىاْ ؽٛٛاي فرشج اٌٌرعشتح. تؼذ رٌه، ذُ إػادج ذٛٛص٠غ الأعّّان تشىتشىً ػشٛ ائٟ خّّظ عّ ٛػاخ تىصافح ذظذظً ااٌٝ 11 عّّىاخ ىٌىً حٛٛع ائٝ ٚذُ اعرخذاَ أستؼح ذشو١ضاخ خرٍٍفح ِٓ ِث١ذ اٌٌص١ااِ١ص وغاَ )25 ٍِغٍغ/ ٌرش ٚ51 عٍُِعُ / ٌرش ٚ111 ٍغ / ٌرش ٚ251 ٍِغٍغ/ ٌرش( ت١ ّا ٌُ٠ رُ لإػافح أٜ ِث١ذ عٌٍّّعّٛػحٛػح اٌٌؼاتطح. تؼذ ٙا٠ح اٌٌرعشتح ذُ اخرثاس ذأش١ش ا ر ٛز تّث١ذ ا ص١ااِ١ص وغاَ ػػٍٝ ظٛٛدج اٌاٌّ١اٖ فٝ أحٛٛاع اٌٌرشت١ح وزٌٌه ذأش١شٖ ػػٍٝ إٔراظ١ح أعّان ا ث طٝ ا ّغرضسػح ا حاٌٌح اٌٌظح١ح ٙا.
أظٙٙشخ ا ٕرائط اٌ رؼٍاٌّرؼٍمحٍمح تعٛٛدج اٌاٌّ١اٖ وا شلُ اٌاٌٙ١ذسٚٚظ١ٕٝ غرِٛٚغرٛ٠اخ الأوغع١ٓ اٌ ّزاب ٔغثح ذشثغ الأوغع١ٓ اٌٚاٌٍّٛححٛحح ظٛٛد اخرلافاخ ؼِٕؼٕٛ٠ح راخ دلاٌٌح إحظائ١ح ت١ٓ عّ ٛػاخ اٌٌرعشتح اٌ خرٍٍفح اٌ عّٚاٌّعّٛػحٛػح اٌٌؼاتطح ح١س ععً ألألً اخرلاف ؼِٕؼٕٜٛ تاٌ ٕغثح شلٌٍُشلُ اٌاٌٙ١ذسٚٚظ١ٕٟ ٚالأوغع١ٓ اٌ ّزاب ٔغثح ذشثغ الاوغع١ٓ فٝ اٌ عّ ٛػح اٌ رٝ ذؼشػد رٌٍرٍٛزٛز تّث١ذ ا ص١اِ ١ص وغاَ تّؼذي 251 ٍِغٍغ/ ٌرش أِا تخظٛٛص ٔغثح ٍِٛححٛحح اٌاٌّ١اج فمذ ععٍٍد أػٍأػٍٝ اخرلاف ؼِٕؼٕٜٛ فٝ ااٌىأٔد ػٕٕذ اٌعشػح اٌ ضِ ٕح اٌ ؼاٌ ١ح أػلا٘ٚأػلاُ٘ أ٘أّ٘١ح وأٔد ػٕٕذ اٌٌعشػح اٌ ؼاٌ ١ح ذحد اٌحادج. وّّا وشفد ٔرائط اٌذساعح اٌ رؼٍٍمح تّؼذي ّٔٛ الأعّّان ٚص٠ادج الاٚ صاالاٚصاْ ػػٓ ظٛٛد فشق وث١ش رٚ دلاٌٌح إحظائ١ح فٟ اٌ صاٌٛصْ اٌ ائٟإٌٙائٟ ٚص٠ادج اٌ صاٌٛصْ
عّ ١غ اٌ ؼاِِلاخ تاٌ ماسٔٔح ِغ اٌ عّ ٛػح اٌٌؼاتطح. تالإػافح إٌإٌٝ رٌٌه ، ٛحع ااْ ظٛٛد فشق ؼِٕؼٕٛٞ تغ١ؾ فٟ اٌ صاٌٛصْ اٌ ائٟإٌٙائٟ ٚص٠ادج اٚ صااٚصاْ الاعّّان وأد ػٕٕذ اٌعشػح اٌ ض ٕح ا ؼاٌ ١ح )51 ٍط/ ٌرش( فٟ ح١ٓ ٌُ٠ ىىٓ ٕان ذغ١١ش ؼشِؼٕٜٛ وث١ش ففٝ اٌعشػاخ ذحد اٌحادج .ترحٍ ١ً ػ١ٕاخ اٌٌغ١شَ اٌ عّؼح ِٓ الأعّان ل١ذ اٌٌرعشتح ٌث١ااْ ٔغثح ا ثشٚٚذ١ٓ، ٛحع أٔأٔٗ ٌُ٠ ىىٓ ٕان ذغ١ش ؼِٕؼٕٛٞ ت١ٓ اٌ ؼاِلاخ اٌ خرٍٍفح اٌ عٚاٌّعّٛػحٛػح اٌٌؼاتطح ذش١ش ا ٕرائط إإٌٝ أْ ٔغثح ا ثشٚٚذ١ٓ ذضداد ِغ ص٠ادج ذشو١ض اٌٌص١ااِ١ص وغاَ ماسٔٔح تاٌ ع ٛػح اٌٌؼاتطح. ت١ ّا ف١ ّا٠ خض ٔغثح الأٌٌث١ِٛ١ٓ، ٌُ٠ ىىٓ ٍص١اِ ١ص وغاصٛوغاَ أٞ ذغ١١ش وث١ش ػػٍٝ الاٌٌث١ِٛ١ٓ فٟ اٌ ؼاِِلاخ اٌ خرٍٍفح، وزٌٌه ٌُ٠ ىىٓ ٕان فشق ؼِٕؼٕٜٛ ت١ٓ ع ٛػاخ اٌٌرعشتح ٚت١ٓ اٌ عّ ٛػح اٌٌؼاتطح. أِِا ف١ّا٠ رؼٍك تا عٍ ٛت١ٌٛ١ٓ، ٌُ٠ غثة ا ص١اِ ١صٛ وغاَ فشلًا ِؼٕٕٛ٠ا وث١شًا ت١ٓ اٌّعّّٛػح اٌؼاتطح وً ِٓ اٌ ؼاِِلاخ اٌ ضِ ٕح ٚذحد اٌحادج. فٟ ح١ٓ واواْ ٕان فشق ؼِٕؼٕٛٞ ٚاػح فٟ غرِٛغرٜٛ اٌ عٍ ٛت١ٌٛ١ٓ ت١ٓ ووً ِٓ اٌعشػاخ اٌ ض ٕح ٚذحد اٌحادج ِغ ظٛٛد فشق ؼِٕؼٕٜٛ تغ١ؾ ػٕذ اٌٌرشو١ض ذحد اٌحاد اٌ ٕخفغ. تالاػافح زٌٌه ٌمذ واْ ٕان اسذفاع حٍِحٛظٛظ فٟ غرِٛغرٜٛ ا عٍ ٛت١ٌٛ١ٓ ِغ ص٠ادج ظشػاخ اٌٌص١اِ ١ص وغاَ . أدٜ اٌٌص١اِ ١صٛ وغاَ إٌإٌٝ ظٛٛد فشق ؼِٕؼٕٛٞ فٟ رٛٛعؾ ل١ّح اٌٌىش٠اذ١ٕ١ٓ فٟ اٌٌغ١شَ ت١ٓ اٌعشػح اٌ ضِ ٕح اٌ ؼاٌ ١ح اٌعشػح اٌ ؼاٌ ١ح ذحد اٌحادج ماسٔٔح تاٌ عّ ٛػح اٌٌؼاتطح، تالإػافح إٌإٌٝ أأْ أػٍأػٍٝ ل١ّح ؼِٕؼٕٛ٠ح ف١ّا٠ رؼٍٍك تّ غرٛتّغرٜٛ اٌٌىش٠اذ١ٕ١ٓ ٛحظد ػٕٕذ اٌعشػح اٌ ؼاٌ ١ح ذحد اٌحادج ت١ ّا ألالألالً وأٔد ػٕٕذ اٌٌرشو١ض اٌإٌّخفغٕخفغ ذحد اٌحاد.
1
الولخص العربى
ٌُ ذظٙش ل١ّح رٛٛعؾ اٌ ١ٛس٠ا فٟ اٌ ذَ ظٛٛد فشق ؼِٕؼٕٜٛ ت١ٓ اٌ ع ٛػح اٌٌؼاتطح اٌعشػاخ ذحد اٌحادج فٟ ح١ٓ وأد اػاػٍٝ ا٘اّ٘١ح ؼِٕؼٕٛ٠ح حٍِٛحٛظحٛظح ػٕٕذ اٌعشػح اٌ ضِ ٕح اٌ ؼاٌ ١ح ماسٔٔح تاٌعشػاخ الأخشٜ. ػلاٚٚج ػػٍٝ رٌه، واواْ ٕان اسذفاع ؽف١ف فٟ غرِٛغرٜٛ اٌ ١ٛس٠ا تؼذ 3 أعات١غ ِٓ اٌٌرؼشع ٌٍعشػحٍعشػح اٌ ٕخفؼح اٌ ضِ ٕح) 25 ٍِغٍغ/ ٌرش( واٚواْ أػأػٍٝ ذشو١ض ٌٍ١ٛس٠ا) 24.4 ٍِغٍغ/ د٠غ١ٍرش( ػٕٕذ اٌعشػح اٌ ض ٕح ا ؼاٌ ١ح) 51 ٍغٍِغ/ ٌرش( .ف١ّا٠ رؼٍك تّ غرٛتّغرٜٛ ا عٍ وٛٛص فٟ ا ذَ فٟ اعّ ان ا ث طٟ إٌ١ٍٟ ،إحظائ١اً، ٌُ٠ رُ ا ىشف ػٓ فش ق راخ دلاٌ ح إحظائ١ح ت١ٓ ظّ ١غ اٌّعّّٛػاخ ا ّؼشػح ٌٍّثّث١ذ اٌ ع ٛػحٚاٌّعّٛػح اٌٌؼاتطح. فثؼذ اٌٌرؼشع ٍص١ااِ١ص وغاَصٛوغاَ ّذج 3 أعات١غ، ٛحع أأْ ِغرٜٛ ا عٍ وٛٛص٠ شذفغ ِغ ص٠ادج ظشػح اٌ رغّاٌرغُّ .إػافح اٌاٌٝ رٌه، ٌُ ذظٙش غرٛ ٠اخ ا ىٛاٌىٌٛ١غر١شٚٚي فٟ اٌ ذَ فٟ الأعّان ا ّؼشػح ٍص١اِ ١ص وغاَ أٞ فٛٛاسق راخ دلاٌٌح إحظائ١ح ت١ٓ اٌ عاٌّعّٛػاخٛػاخ ا ّؼشػح ٌٍّثّث١ذ اٌ ع ٛػحٚاٌّعّٛػح اٌٌؼاتطح .تا ٕغثح ٌٍّؤششاخّؤششاخ اٌح١ٛ٠ح لإظٙاد اٌ رأوغذٞ فٟ ا ذَ، أشش ا ص١اِ ١ص وغاَ ع ثًا ػٍٝ اٌّؤششاخ ا ح١ٛ٠ح لإظٙ اد ا رأوغذٞ فٟ ا ث طٟ إٌ١ٍٟ .ِٚغ رٌه، ٌُ ذىذىٓ ٕان فشٚٚق راخ دلاٌٌح إحظائ١ح فٟ غرٛ ٠اخ أٔٔض٠ُ) SOD( ت١ٓ اٌ عّ ٛػاخ اٌ ّؼشػح ٍص١اِ ١ص وغاَ اٌ عّٚاٌّعّٛػحٛػح اٌٌؼاتطح .اِا تا ٕغثح لإٔض٠ُ) MDA(، ٌُ ٠لاحع اٜ فشٚٚق راخ دلاٌٌح إحظائ١ح ت١ٓ اٌ عّ ٛػاخ اٌ ّؼشػح ٌٍّثّث١ذ ىٌٚىٓ واواْ ٕان فشلا ؼِٕؼٕٛ٠ا وث١شا ت١ ٙا ٚت١ٓ اٌ ع ٛػح اٌٌؼاتطح. ػلاٚٚج ػػٍٝ رٌٌه، ٌُ ذىذىٓ ٕ٘انٕان فشٚٚق راخ دلاٌٌح إحظائ١ح فٟ غرٛ ٠اخ اٌٌمذسج اٌ ىٍ ١ح ّؼاداخ الأوغذجTAC) ( ت١ٓ اٌ عّ ٛػح اٌ ّؼشػح ٍص١اِ ١ص وغاَ اٌ عّٚاٌّعّٛػحٛػح اٌٌؼاتطح ت١ ّا وأد ألألً أ٘أّ٘١ح ؼِٕؼٕٛ٠ح حٍِٛحٛظحٛظح ػٕٕذ اٌعشػح اٌ ؼاٌ ١ح ذحد اٌحادج .
ذُ ل١اط ذأش١ش ِث١ذ ا ص١اِ ١ص وغاَ ػػٍٝ اٌٌرؼث١ش اٌع١ٕٟ ٌٍعٍع١ٕاخ اٌ ّشذثطح تاٌتإٌّٛ اٌٚإٌّاػحٕاػح الإظٙٙاد تٛاعطح ذمٕ ١ح
)RT-PCR( ػػٓ ؽش٠ك ل١اط اٌعش٠ٍ١ٓ ٚ TLR2 ٚCAT ففٟ أٔٔغعح ا ىثذ اٌ عّّؼح ِٓ الأعّّان ل١ذ اٌٌرعشتح. ذث١ٓ ظٛٛد اخرلافاخ ؼِٕؼٕٛ٠ح وث١شج فٟ اٌٌرؼث١ش اٌع١ٕٟ ٍصلاز ظ١ٕاخ ت١ٓ ظظّ١غ اٌ عّ ٛػاخ اٌ ّؼشػح ٍص١اِ ١صٛ وغاَ اٌ عّٚاٌّعّٛػحٛػح اٌٌؼاتطح. تالإػافح إإٌٝ رٌه، ٛحع ااْ ألألً أ٘أّ٘١ح ؼِٕؼٕٛ٠ح ف١ّا٠ رؼٍٍك تاٌٌرؼث١ش اٌع١ٕٟ ىٌىً ِٓ اٌعش٠ٍ١ٓ اٌٚاٌىاذلاصٌىاذلاص (CAT) ػٕٕذ اٌعشػح اٌ ؼاٌ ١ح ذحد اٌحادج، فٟ ح١ٓ وأٔد ألألً أ٘أّ٘١ح ؼِٕؼٕٛ٠ح ف١ّا٠ رؼٍٍك تع١ٕاخ اٌ ٕاػح) (TLR2 ػٕٕذ اٌٌعشػح اٌ ضِ ٕح اٌ ٕخفؼح. ػلاٚٚج ػٍػٍٝ رٌٌه، واْ ٕان ص٠ادج وث١شج فٟ اٌٌرؼث١ش اٌع١ٕٟ ٌـ TLR2 فٟ ح١ٓ واواْ ٕان أٔماص فٝ ذٕظ١ُ اٌٌرؼث١ش اٌع١ٕٟ ىٌىً ِٓ اٌعش٠ٍ١ٓ ٚCAT تشىتشىً وث١ش. ح١س وشفد اٌ ٕرائط أأْ رٛٛعؾ ذغ١ش اٌٌط١ح ٍعٌٍع١ٕاخ اٌ ّشذثطح تاٌتإٌّٛ )اٌعش٠ٍ١ٓ( أٔخفغ تض٠ادج ظشػح اٌٌص١اِ ١ص وغاَ . تاٌ ٕغثح ّرثم١اخ اٌٌص١اِ ١ص وغاَ فٟ ٌحٛ َ الأعّان، ذث١ٓ ظٛٛد تما٠ا ّث١ذ اٌٌص١ااِ١ص وغاَ فٟ ػؼلاخ تم١ُ خرٍٍفح ت١ٓ ع ٛػاخ اٌٌرعشتح اٌ ع ٛػحٚاٌّعّٛػح ااٌؼاتطح وأد أػأػٍٝ ٔغثح ػٕذ اٌعشػح اٌ ؼاٌ ١ح ذحد اٌٌحادج )251 ٍغٍِغ/ ٌرش(. اخ١شا، ذُ دساعح ذأش١ش اٌٌص١اِ ١صٛ وغاَ ػٍػٍٝ ِؼذي اٌ فٛٛق فٝ عّ ٛػاخ اٌٌرعشتح ٚذث١ٓ ظٛٛد فشٚٚق ؼِؼٕٛ٠ح فٟ ِؼذي اٌ ٛف١اخ ت١ٓ اٌ عّ ٛػاخ اٌ ّؼشػح ٌٍّثّث١ذ اٌ عّٚاٌّعّٛػحٛػح اٌٌؼاتطح تاعرصٕٕاء ااْ اٌعشػح اٌ ؼاٌ ١ح ذحد اٌحادج )251 ٍِغٍغ/ ٌرش( ٌٚٛحعٛحع أأْ ص٠ادج ِؼذي اٌ ٛف١اخ وأٔد ِشذثطح تض٠ادج ظشػح اٌٌص١اِ ١صٛ وغاَ ت١ ّا ٌُ ٠رُ ذغع١ً أٜ ٚف١اخ فٟ اٌ عّ ٛػح اٌٌؼاتطح أشٕٕاء اٌٌرؼشع ٌٍّثّث١ذ خلاي
ِذج اٌٌرعشتح.
فيوا يلى بعض التىصيات التى يوكن وضعها فى الاعتبار بناء على النتائج التى تن التىصل إليها فى الدراسة الحالية:
1. ٠عة الا٘ ر اَ تا رحٍ ١ً ا ذٚ سٞ ٌؼ١ٕاخ اٌاٌّ١اٖ ِٓ ا ّغطحاخ اٌ ّائ١ح لاورشاف تما٠ا ا ّث١ذاخ اٌحشش٠ح تاعرخذاَ ذمذمٕ١ح) HPLC( ٌرعٕة طٛٛي اٌاٌّ١اٖ اٌٛشحاٌٍّٛشح إإٌٝ أحٛاع الاعرضساع ا غ ىٝ ّا لذ٠ رغثة فٝ حذٚز فٛٛق ظّ اػظّاػٟ لأعّان.
2. اٌ رٕٕث١ٗ ػػٍٝ أطحاب ا ّضاسع اٌ غّى١ح ترعٕٕة اعرخذاَ ِ١اٖ اٌٌظشف ا ضساػٟ فٟ ذشت١ح الأعّّان لثلثً ؼاٌعح زٖ اٌاٌّ١اٖ رخٌٍرخٍضٍض ِٓ ِرثم١اخ اٌ ّث١ذاخ اٌحشش٠ح صِصً اٌٌص١اِ ١ص وغاَ .
3. اٌ رخٍض تشىتشىً طحٟ ِٓ ِ١اٖ اٌٌظشف اٌ ظحٟ اٌ خٍٚاٌّخٍفاخٍفاخ اٌ ٕاذعح ػػٓ اٌ ظأاٌّظأغٔغ تؼ١ذا ػػٓ اٌ ّغطحاخ اٌ ّائ١ح.
2
______________________________________________
كليــــح الطــة الثيطــــــرى قسن صحح الحيواى والأهراض الوشرركح
ذأثير ذلوز الوياٍ توثيد الثياهيثوكسام علي الحالح الصحيح لأسواك الثلطي الٌيلي
رسالـــح علويــــح هقدهـــح إلي الدراساخ العليا
كليح الطة الثيطـــــــرى – جاهعح الاسكٌٌدريـــــــــــــــــــــح اسريفاء للدراساخ العليا الوقررج للحصول علي درجح الواجسريــــر في العلــــــوم الطثيــــــــح الثيطريــــــــــــح
تخصص
صحح الحيواى
هقدهح هي
ط. ب/. الشيواء السيد ًصحي اتراهين
تكالريوس العلـــــوم الطثيـــــح الثيطريــــــح 0202
كليح الطة الثيطرى ـ جاهعح الأسكٌدريح
0204
ذحد إشــــــــــراف
أ.د /.محمد السيد عثد اللطيف ًصير
أستاذ ورئيس قسم صحة الحيىان والأمراض المشتركة
كلية الطب البيطري – جامعة الأسكندرية
د/ علاء محمد السيد هٌٌصور
مدرس صحة الحيىان
قسم صحة الحيىان والأمراض المشتركة كلية الطب البيطري – جامعة الأسكندرية
د/ رحاب علي عثد العزيز السيد
باحج أول بقسم أمراض الأسماك – معهد بحىث الصحة الحيىانية
الأسكندرية